Rh4AG264100

Cell wall vacuolar inhibitor of fructosidase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
58028454 .. 58029109
656 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG264100.1

Sequence Viewer

Length: 168 bp
ATGGCTGATCTTGTTCTGTCCAATGCAACTGATACACTGGATTACATCCATGGCCTACTCAAGCAATCCCCAGAAGAAGATTTGCAGAAGCCTTTGGCAAACTGTGCAGAGCTGTACATTCCAGTGAGCAGTGTCATTTCGGAGTTTAAGGTTGAGCGTTTGGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.08

Weight (kDa)

4.4

Isoelectric Point (pI)

49.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014918)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 116
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
AoxI GGCC 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 49
Bse1I ACTGG 2 cut(s) 42, 122
BseDI CCNNGG 1 cut(s) 49
BseGI GGATG 1 cut(s) 45
BseNI ACTGG 2 cut(s) 42, 122
BsgI GTGCAG 1 cut(s) 126
BshFI GGCC 1 cut(s) 54
BsnI GGCC 1 cut(s) 54
Bsp1407I TGTACA 1 cut(s) 114
Bsp143I GATC 1 cut(s) 7
Bsp19I CCATGG 1 cut(s) 49
BspANI GGCC 1 cut(s) 54
BsrGI TGTACA 1 cut(s) 114
BsrI ACTGG 2 cut(s) 42, 122
BssECI CCNNGG 1 cut(s) 49
BssMI GATC 1 cut(s) 7
BssT1I CCWWGG 1 cut(s) 49
Bst4CI ACNGT 1 cut(s) 104
BstAPI GCANNNNNTGC 1 cut(s) 104
BstAUI TGTACA 1 cut(s) 114
BstDSI CCRYGG 1 cut(s) 49
BstF5I GGATG 1 cut(s) 45
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BstMWI GCNNNNNNNGC 1 cut(s) 104
BsuRI GGCC 1 cut(s) 54
BtgI CCRYGG 1 cut(s) 49
BtsCI GGATG 1 cut(s) 45
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 3 cut(s) 35, 129, 136
Csp6I GTAC 1 cut(s) 115
CviAII CATG 1 cut(s) 50
CviJI RGCY 4 cut(s) 5, 54, 91, 112
CviKI_1 RGCY 4 cut(s) 5, 54, 91, 112
CviQI GTAC 1 cut(s) 115
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eco130I CCWWGG 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 49
ErhI CCWWGG 1 cut(s) 49
FaeI CATG 1 cut(s) 53
FaiI YATR 1 cut(s) 51
FatI CATG 1 cut(s) 49
FokI GGATG 1 cut(s) 32
HaeIII GGCC 1 cut(s) 54
Hin1II CATG 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 142
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4V TGCA 3 cut(s) 26, 85, 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
Hsp92II CATG 1 cut(s) 53
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 3 cut(s) 23, 84, 135
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 2 cut(s) 86, 89
MseI TTAA 1 cut(s) 147
MslI CAYNNNNRTG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 104
NcoI CCATGG 1 cut(s) 49
NdeII GATC 1 cut(s) 7
NlaIII CATG 1 cut(s) 53
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
RseI CAYNNNNRTG 1 cut(s) 122
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 1 cut(s) 7
SetI ASST 2 cut(s) 114, 153
SgeI CNNG 6 cut(s) 23, 50, 62, 73, 83, 134
SmiMI CAYNNNNRTG 1 cut(s) 122
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
StyI CCWWGG 1 cut(s) 49
TaaI ACNGT 1 cut(s) 104
TatI WGTACW 1 cut(s) 114
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 3 cut(s) 42, 129, 136
TspRI CASTG 3 cut(s) 42, 129, 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.