Rh4BG092800

No apical meristem (NAM) protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0006410
Physical Location & Seq
Forward (+)
15890163 .. 15890726
564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG092800.1

Sequence Viewer

Length: 228 bp
ATGGGATCCCAGAAAGGAGTAGTAGTGAGCTCTGATTTGCTTCCAGTTGGGTTTAGGTTTATGCCAACAGATGAAGAGCTGGTCACTCACTATTTAATGAACAAAGCTTGTTCCAGAGCTGTACCAGTTGCTGATGCGATTCAGGAGATCGATGCGACTCGGTTTTACAGCAACCATCCAAAGAATCTAGTCTCAGTCCATGAGCTAGCCTGGCCTCAAAAACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

75

Amino Acids

8.38

Weight (kDa)

6.24

Isoelectric Point (pI)

58.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM PF02365 15 - 66 1.7e-10 No apical meristem (NAM) protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 13
AfaI GTAC 1 cut(s) 123
AjnI CCWGG 1 cut(s) 209
AluBI AGCT 5 cut(s) 30, 79, 107, 119, 205
AluI AGCT 5 cut(s) 30, 79, 107, 119, 205
Alw21I GWGCWC 1 cut(s) 32
Alw26I GTCTC 1 cut(s) 196
AlwI GGATC 1 cut(s) 13
AlwNI CAGNNNCTG 1 cut(s) 131
AoxI GGCC 1 cut(s) 212
AsuNHI GCTAGC 1 cut(s) 205
BamHI GGATCC 1 cut(s) 5
BanII GRGCYC 1 cut(s) 32
Bbv12I GWGCWC 1 cut(s) 32
BccI CCATC 1 cut(s) 183
BciT130I CCWGG 1 cut(s) 211
BcoDI GTCTC 1 cut(s) 196
BfaI CTAG 2 cut(s) 188, 206
Bme1390I CCNGG 1 cut(s) 211
BmiI GGNNCC 1 cut(s) 7
BmrFI CCNGG 1 cut(s) 211
BmsI GCATC 2 cut(s) 124, 142
BmtI GCTAGC 1 cut(s) 209
Bsa29I ATCGAT 1 cut(s) 150
BsaXI ACNNNNNCTCC 2 cut(s) 9, 39
Bse1I ACTGG 2 cut(s) 44, 125
BseBI CCWGG 1 cut(s) 211
BseCI ATCGAT 1 cut(s) 150
BseGI GGATG 1 cut(s) 175
BseMII CTCAG 1 cut(s) 207
BseNI ACTGG 2 cut(s) 44, 125
BshFI GGCC 1 cut(s) 214
BshVI ATCGAT 1 cut(s) 150
BsiHKAI GWGCWC 1 cut(s) 32
BsmAI GTCTC 1 cut(s) 196
BsnI GGCC 1 cut(s) 214
Bsp1286I GDGCHC 1 cut(s) 32
Bsp143I GATC 2 cut(s) 5, 147
BspANI GGCC 1 cut(s) 214
BspCNI CTCAG 1 cut(s) 206
BspDI ATCGAT 1 cut(s) 150
BspLI GGNNCC 1 cut(s) 7
BspOI GCTAGC 1 cut(s) 209
BspPI GGATC 1 cut(s) 13
BspQI GCTCTTC 1 cut(s) 69
BsrI ACTGG 2 cut(s) 44, 125
BssMI GATC 2 cut(s) 5, 147
Bst2UI CCWGG 1 cut(s) 211
Bst6I CTCTTC 1 cut(s) 69
BstC8I GCNNGC 1 cut(s) 207
BstDEI CTNAG 1 cut(s) 193
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 2 cut(s) 8, 150
BstMAI GTCTC 1 cut(s) 196
BstMBI GATC 2 cut(s) 5, 147
BstMWI GCNNNNNNNGC 1 cut(s) 211
BstNI CCWGG 1 cut(s) 211
BstSCI CCNGG 1 cut(s) 209
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
Bsu15I ATCGAT 1 cut(s) 150
BsuRI GGCC 1 cut(s) 214
BsuTUI ATCGAT 1 cut(s) 150
BtsCI GGATG 1 cut(s) 175
Cac8I GCNNGC 1 cut(s) 207
CaiI CAGNNNCTG 1 cut(s) 131
ClaI ATCGAT 1 cut(s) 150
Csp6I GTAC 1 cut(s) 122
CviAII CATG 1 cut(s) 200
CviJI RGCY 7 cut(s) 30, 79, 107, 119, 205, 209, 214
CviKI_1 RGCY 7 cut(s) 30, 79, 107, 119, 205, 209, 214
CviQI GTAC 1 cut(s) 122
DdeI CTNAG 1 cut(s) 193
DpnI GATC 2 cut(s) 7, 149
DpnII GATC 2 cut(s) 5, 147
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
Ecl136II GAGCTC 1 cut(s) 30
Eco24I GRGCYC 1 cut(s) 32
Eco53kI GAGCTC 1 cut(s) 30
EcoICRI GAGCTC 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 209
EcoT38I GRGCYC 1 cut(s) 32
FaeI CATG 1 cut(s) 203
FaiI YATR 2 cut(s) 62, 201
FatI CATG 1 cut(s) 199
FokI GGATG 1 cut(s) 162
FriOI GRGCYC 1 cut(s) 32
FspBI CTAG 2 cut(s) 188, 206
HaeIII GGCC 1 cut(s) 214
Hin1II CATG 1 cut(s) 203
HindIII AAGCTT 1 cut(s) 105
HinfI GANTC 3 cut(s) 139, 157, 184
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 2 cut(s) 114, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 211
HpyF3I CTNAG 1 cut(s) 193
Hsp92II CATG 1 cut(s) 203
Kzo9I GATC 2 cut(s) 5, 147
LguI GCTCTTC 1 cut(s) 69
LpnPI CCDG 8 cut(s) 23, 57, 65, 127, 128, 138, 196, 223
LweI GCATC 2 cut(s) 124, 142
MaeI CTAG 2 cut(s) 188, 206
MaeIII GTNAC 1 cut(s) 82
MalI GATC 2 cut(s) 7, 149
MboI GATC 2 cut(s) 5, 147
MboII GAAGA 1 cut(s) 86
MflI RGATCY 1 cut(s) 5
MhlI GDGCHC 1 cut(s) 32
MlyI GAGTC 1 cut(s) 151
MnlI CCTC 1 cut(s) 225
MseI TTAA 1 cut(s) 95
MspR9I CCNGG 1 cut(s) 211
MvaI CCWGG 1 cut(s) 211
MwoI GCNNNNNNNGC 1 cut(s) 211
NdeII GATC 2 cut(s) 5, 147
NheI GCTAGC 1 cut(s) 205
NlaIII CATG 1 cut(s) 203
NlaIV GGNNCC 1 cut(s) 7
NmuCI GTSAC 1 cut(s) 82
PciSI GCTCTTC 1 cut(s) 69
PfeI GAWTC 2 cut(s) 139, 184
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
Psp124BI GAGCTC 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 209
PspGI CCWGG 1 cut(s) 209
PspN4I GGNNCC 1 cut(s) 7
PstNI CAGNNNCTG 1 cut(s) 131
PsuI RGATCY 1 cut(s) 5
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
SacI GAGCTC 1 cut(s) 32
SapI GCTCTTC 1 cut(s) 69
SaqAI TTAA 1 cut(s) 95
Sau3AI GATC 2 cut(s) 5, 147
SchI GAGTC 1 cut(s) 151
ScrFI CCNGG 1 cut(s) 211
SduI GDGCHC 1 cut(s) 32
SetI ASST 6 cut(s) 32, 59, 81, 109, 121, 207
SfaNI GCATC 2 cut(s) 124, 142
SspMI CTAG 2 cut(s) 188, 206
SstI GAGCTC 1 cut(s) 32
StyD4I CCNGG 1 cut(s) 209
TaqI TCGA 1 cut(s) 150
TfiI GAWTC 2 cut(s) 139, 184
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 2 cut(s) 87, 113
XspI CTAG 2 cut(s) 188, 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.