Rh4BG127800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
21456791 .. 21457901
1111 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG127800.1

Sequence Viewer

Length: 153 bp
ATGGTGGATGTTCCAGAGTTCAAGGCCCCCGTTTCGGAGATGAATCGGAGCAACTCCGAAAGAAGTGTGCTTCGGGTTTCCGAGAGCAGGACCAATAATATCATGCAAAGTAATAGTAACTACTGCAGCCTCTTCCGTTTCAATCATAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.8

Weight (kDa)

7.98

Isoelectric Point (pI)

72.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 34, 87
AgsI TTSAA 2 cut(s) 22, 142
AluBI AGCT 1 cut(s) 150
AluI AGCT 1 cut(s) 150
AoxI GGCC 1 cut(s) 24
ApeKI GCWGC 1 cut(s) 126
AspS9I GGNCC 2 cut(s) 25, 90
AvaII GGWCC 1 cut(s) 90
BbvI GCAGC 1 cut(s) 138
BfmI CTRYAG 1 cut(s) 124
BisI GCNGC 1 cut(s) 127
BlsI GCNGC 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 90
BmgT120I GGNCC 2 cut(s) 25, 90
BmiI GGNNCC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 2 cut(s) 34, 87
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 2 cut(s) 34, 87
BseXI GCAGC 1 cut(s) 138
BshFI GGCC 1 cut(s) 26
BslI CCNNNNNNNGG 2 cut(s) 34, 87
BsnI GGCC 1 cut(s) 26
BspANI GGCC 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 27
BspMAI CTGCAG 1 cut(s) 128
Bst6I CTCTTC 1 cut(s) 137
BstF5I GGATG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 124
BstV1I GCAGC 1 cut(s) 138
BsuRI GGCC 1 cut(s) 26
BtsCI GGATG 1 cut(s) 13
Cfr13I GGNCC 2 cut(s) 25, 90
CviAII CATG 1 cut(s) 103
CviJI RGCY 3 cut(s) 26, 129, 150
CviKI_1 RGCY 3 cut(s) 26, 129, 150
Eam1104I CTCTTC 1 cut(s) 137
EarI CTCTTC 1 cut(s) 137
Eco47I GGWCC 1 cut(s) 90
EcoO109I RGGNCCY 1 cut(s) 25
FaeI CATG 1 cut(s) 106
FaiI YATR 2 cut(s) 104, 147
FatI CATG 1 cut(s) 102
Fnu4HI GCNGC 1 cut(s) 127
FokI GGATG 1 cut(s) 20
Fsp4HI GCNGC 1 cut(s) 127
GluI GCNGC 1 cut(s) 127
HaeIII GGCC 1 cut(s) 26
Hin1II CATG 1 cut(s) 106
HinfI GANTC 1 cut(s) 43
Hpy188I TCNGA 4 cut(s) 37, 48, 58, 82
Hpy188III TCNNGA 1 cut(s) 14
HpyCH4V TGCA 2 cut(s) 106, 126
Hsp92II CATG 1 cut(s) 106
LmnI GCTCC 1 cut(s) 48
LpnPI CCDG 2 cut(s) 27, 73
Lsp1109I GCAGC 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 116
MboII GAAGA 1 cut(s) 124
MnlI CCTC 1 cut(s) 140
NlaIII CATG 1 cut(s) 106
NlaIV GGNNCC 1 cut(s) 27
PfeI GAWTC 1 cut(s) 43
PkrI GCNGC 1 cut(s) 128
PspN4I GGNNCC 1 cut(s) 27
PspPI GGNCC 2 cut(s) 25, 90
PstI CTGCAG 1 cut(s) 128
SatI GCNGC 1 cut(s) 127
Sau96I GGNCC 2 cut(s) 25, 90
SetI ASST 1 cut(s) 152
SfcI CTRYAG 1 cut(s) 124
SgeI CNNG 7 cut(s) 26, 34, 41, 86, 94, 100, 115
SinI GGWCC 1 cut(s) 90
TfiI GAWTC 1 cut(s) 43
TseI GCWGC 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 56
TspGWI ACGGA 1 cut(s) 125
VpaK11BI GGWCC 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.