Rh4DG199900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
38890887 .. 38891999
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG199900.1

Sequence Viewer

Length: 213 bp
ATGGTGGATGTTCCAGAGTTCAAGGCCCCCGTTTCGGAGACGAATCGGAGCAACTCCAAAAGAAGTGTGTTTCTGGTTTCCGAGTTGCAAACCAAAGCGATTAGTATTGGTTTCAGGCGATTATGCGAACGCTATAGAGAGTTAAATAGGACCAATAATATCATGCAAAGTAATAGTAACTACTGCAACCTCTTCCGTTTTAATCATAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.25

Weight (kDa)

9.89

Isoelectric Point (pI)

55.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 1 cut(s) 210
AluI AGCT 1 cut(s) 210
Alw26I GTCTC 1 cut(s) 32
AoxI GGCC 1 cut(s) 24
AspS9I GGNCC 2 cut(s) 25, 150
AvaII GGWCC 1 cut(s) 150
BcoDI GTCTC 1 cut(s) 32
BfmI CTRYAG 1 cut(s) 133
Bme18I GGWCC 1 cut(s) 150
BmgT120I GGNCC 2 cut(s) 25, 150
BmiI GGNNCC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 34
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 34
BshFI GGCC 1 cut(s) 26
BslI CCNNNNNNNGG 1 cut(s) 34
BsmAI GTCTC 1 cut(s) 32
BsmBI CGTCTC 1 cut(s) 32
BsnI GGCC 1 cut(s) 26
BspANI GGCC 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 27
Bst6I CTCTTC 1 cut(s) 197
BstF5I GGATG 1 cut(s) 13
BstMAI GTCTC 1 cut(s) 32
BstSFI CTRYAG 1 cut(s) 133
BsuRI GGCC 1 cut(s) 26
BtsCI GGATG 1 cut(s) 13
Cfr13I GGNCC 2 cut(s) 25, 150
CviAII CATG 1 cut(s) 163
CviJI RGCY 2 cut(s) 26, 210
CviKI_1 RGCY 2 cut(s) 26, 210
Eam1104I CTCTTC 1 cut(s) 197
EarI CTCTTC 1 cut(s) 197
Eco47I GGWCC 1 cut(s) 150
EcoO109I RGGNCCY 1 cut(s) 25
Esp3I CGTCTC 1 cut(s) 32
FaeI CATG 1 cut(s) 166
FaiI YATR 4 cut(s) 124, 135, 164, 207
FatI CATG 1 cut(s) 162
FokI GGATG 1 cut(s) 20
HaeIII GGCC 1 cut(s) 26
Hin1II CATG 1 cut(s) 166
HinfI GANTC 1 cut(s) 43
Hpy188I TCNGA 3 cut(s) 37, 48, 82
Hpy188III TCNNGA 1 cut(s) 14
HpyCH4V TGCA 3 cut(s) 88, 166, 186
Hsp92II CATG 1 cut(s) 166
LmnI GCTCC 1 cut(s) 48
LpnPI CCDG 3 cut(s) 27, 59, 100
MaeIII GTNAC 1 cut(s) 176
MboII GAAGA 1 cut(s) 184
MnlI CCTC 1 cut(s) 200
MseI TTAA 2 cut(s) 143, 201
NlaIII CATG 1 cut(s) 166
NlaIV GGNNCC 1 cut(s) 27
PfeI GAWTC 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 27
PspPI GGNCC 2 cut(s) 25, 150
SaqAI TTAA 2 cut(s) 143, 201
Sau96I GGNCC 2 cut(s) 25, 150
SetI ASST 2 cut(s) 192, 212
SfcI CTRYAG 1 cut(s) 133
SgeI CNNG 7 cut(s) 26, 34, 41, 86, 94, 127, 175
SinI GGWCC 1 cut(s) 150
TfiI GAWTC 1 cut(s) 43
Tru1I TTAA 2 cut(s) 143, 201
Tru9I TTAA 2 cut(s) 143, 201
TspGWI ACGGA 1 cut(s) 185
VpaK11BI GGWCC 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.