Rh4BG381700

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
53704183 .. 53704482
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG381700.1

Sequence Viewer

Length: 300 bp
ATGAGGATGACTCTGGACTCCATATGTAAGGTGGGATTTGGTGTAGAGATTGGAACCCTGGCTCCAGATCTACCAGATAATCAGTTTGCCCAGGCCTTCGACACTGCAAACATAATTGTCACATATCGATTCATTGATCCACTATGGAAAATAAAGAAATTCTTAAATTGGGGATCAGAAGCTTTACTTGACAAGAGCATGAAAACCATAGATGATTTTACATATTCTGTAATTCGGAAAAGGAAATCAGAGATAAAAGAAGCTCAACAGAGTTCAGATAAAAACCTGGTAAATTGGTAA

Protein Analysis

99

Amino Acids

11.41

Weight (kDa)

7.81

Isoelectric Point (pI)

23.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011009)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 131, 181
AcsI RAATTY 1 cut(s) 158
AjnI CCWGG 3 cut(s) 57, 90, 285
AloI GAACNNNNNNTCC 2 cut(s) 46, 78
AluBI AGCT 2 cut(s) 182, 263
AluI AGCT 2 cut(s) 182, 263
AlwI GGATC 2 cut(s) 131, 181
AoxI GGCC 1 cut(s) 93
ApoI RAATTY 1 cut(s) 158
BciT130I CCWGG 3 cut(s) 59, 92, 287
BglII AGATCT 1 cut(s) 67
Bme1390I CCNGG 3 cut(s) 59, 92, 287
BmiI GGNNCC 2 cut(s) 55, 63
BmrFI CCNGG 3 cut(s) 59, 92, 287
BplI GAGNNNNNCTC 1 cut(s) 27
BpmI CTGGAG 1 cut(s) 48
Bsa29I ATCGAT 1 cut(s) 127
BsaJI CCNNGG 2 cut(s) 57, 90
BsaXI ACNNNNNCTCC 2 cut(s) 46, 76
BseBI CCWGG 3 cut(s) 59, 92, 287
BseCI ATCGAT 1 cut(s) 127
BseDI CCNNGG 2 cut(s) 57, 90
BseGI GGATG 1 cut(s) 12
BshFI GGCC 1 cut(s) 95
BshVI ATCGAT 1 cut(s) 127
BsnI GGCC 1 cut(s) 95
Bsp143I GATC 3 cut(s) 67, 136, 173
BspANI GGCC 1 cut(s) 95
BspDI ATCGAT 1 cut(s) 127
BspLI GGNNCC 2 cut(s) 55, 63
BspPI GGATC 2 cut(s) 131, 181
BssECI CCNNGG 2 cut(s) 57, 90
BssMI GATC 3 cut(s) 67, 136, 173
Bst2UI CCWGG 3 cut(s) 59, 92, 287
BstF5I GGATG 1 cut(s) 12
BstKTI GATC 3 cut(s) 70, 139, 176
BstMBI GATC 3 cut(s) 67, 136, 173
BstNI CCWGG 3 cut(s) 59, 92, 287
BstSCI CCNGG 3 cut(s) 57, 90, 285
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
Bsu15I ATCGAT 1 cut(s) 127
BsuRI GGCC 1 cut(s) 95
BsuTUI ATCGAT 1 cut(s) 127
BtsCI GGATG 1 cut(s) 12
BtsI GCAGTG 1 cut(s) 102
BtsIMutI CAGTG 1 cut(s) 102
ClaI ATCGAT 1 cut(s) 127
CsiI ACCWGGT 1 cut(s) 285
CviAII CATG 1 cut(s) 199
CviJI RGCY 4 cut(s) 62, 95, 182, 263
CviKI_1 RGCY 4 cut(s) 62, 95, 182, 263
DpnI GATC 3 cut(s) 69, 138, 175
DpnII GATC 3 cut(s) 67, 136, 173
Eco147I AGGCCT 1 cut(s) 95
EcoRII CCWGG 3 cut(s) 57, 90, 285
FaeI CATG 1 cut(s) 202
FaiI YATR 8 cut(s) 23, 25, 113, 124, 145, 200, 209, 223
FalI AAGNNNNNCTT 4 cut(s) 146, 178, 171, 203
FatI CATG 1 cut(s) 198
FauNDI CATATG 1 cut(s) 23
FokI GGATG 1 cut(s) 19
GsuI CTGGAG 1 cut(s) 48
HaeIII GGCC 1 cut(s) 95
Hin1II CATG 1 cut(s) 202
HindIII AAGCTT 1 cut(s) 180
HinfI GANTC 3 cut(s) 10, 17, 129
Hpy188I TCNGA 4 cut(s) 178, 237, 250, 277
Hpy188III TCNNGA 2 cut(s) 14, 65
HpyAV CCTTC 1 cut(s) 106
HpyCH4V TGCA 1 cut(s) 107
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 3 cut(s) 67, 136, 173
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 7 cut(s) 44, 71, 77, 78, 87, 104, 272
MabI ACCWGGT 1 cut(s) 285
MaeIII GTNAC 1 cut(s) 118
MalI GATC 3 cut(s) 69, 138, 175
MboI GATC 3 cut(s) 67, 136, 173
MflI RGATCY 1 cut(s) 67
MluCI AATT 5 cut(s) 114, 158, 166, 231, 292
MlyI GAGTC 2 cut(s) 4, 11
MseI TTAA 1 cut(s) 164
MspR9I CCNGG 3 cut(s) 59, 92, 287
MvaI CCWGG 3 cut(s) 59, 92, 287
NdeI CATATG 1 cut(s) 23
NdeII GATC 3 cut(s) 67, 136, 173
NlaIII CATG 1 cut(s) 202
NlaIV GGNNCC 2 cut(s) 55, 63
NmuCI GTSAC 1 cut(s) 118
PceI AGGCCT 1 cut(s) 95
PfeI GAWTC 1 cut(s) 129
PleI GAGTC 2 cut(s) 4, 11
PpsI GAGTC 2 cut(s) 4, 11
Psp6I CCWGG 3 cut(s) 57, 90, 285
PspGI CCWGG 3 cut(s) 57, 90, 285
PspN4I GGNNCC 2 cut(s) 55, 63
PsuI RGATCY 1 cut(s) 67
SaqAI TTAA 1 cut(s) 164
Sau3AI GATC 3 cut(s) 67, 136, 173
SchI GAGTC 2 cut(s) 4, 11
ScrFI CCNGG 3 cut(s) 59, 92, 287
SetI ASST 4 cut(s) 33, 184, 265, 288
SexAI ACCWGGT 1 cut(s) 285
Sse9I AATT 5 cut(s) 114, 158, 166, 231, 292
SseBI AGGCCT 1 cut(s) 95
StuI AGGCCT 1 cut(s) 95
StyD4I CCNGG 3 cut(s) 57, 90, 285
TaqI TCGA 2 cut(s) 99, 127
TasI AATT 5 cut(s) 114, 158, 166, 231, 292
TfiI GAWTC 1 cut(s) 129
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
TspDTI ATGAA 2 cut(s) 121, 215
TspRI CASTG 1 cut(s) 109
XapI RAATTY 1 cut(s) 158
XcmI CCANNNNNNNNNTGG 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.