Rh5BG424400

Pentatricopeptide repeat-containing protein At1g07740

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
68571076 .. 68571297
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG424400.1

Sequence Viewer

Length: 222 bp
ATGTTGAAAAGTAAACACTGTCCTCGGTTGAAAACATTTGAGTGCTTGGTTACAGGACTATTGAAGTGTGGGAATGTTGATGGTGCTTGTTTTGTCTTGGAGGAGATGGAAAACAGAAATATGCAATTATGTTGTGAAGCTTGGGAAGCACCAGTTGTTGATGCTTGTGGTAAGGACATTGTTGCAGGTGAGAAAATGACTGAAGTCATATCTGCCGACTAA

Protein Analysis

73

Amino Acids

8.02

Weight (kDa)

4.87

Isoelectric Point (pI)

34.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013851)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G07740
fragaria_vesca FvH4_3g34780
malus_domestica MD04G1036700.v1.1 MD11G1115700.v1.1 MD12G1096600.v1.1
prunus_persica Prupe.6G007300_v2.0.a1
pyrus_communis pycom03g08320
rosa_chinensis RchiOBHm_Chr5g0062521
rosa_laevigata RLG00000035563
rosa_multiflora Rmu_sc0004988.1_g000027
rosa_roxburghii Rroxscaffold_1G00018090
rosa_rugosa Rorug05G0350400
rosa_samantha Rh5AG410400 Rh5BG424400 Rh5CG448100 Rh5DG438700
rosa_wichuraiana Rw5G038640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 176
Acc36I ACCTGC 1 cut(s) 176
AcuI CTGAAG 1 cut(s) 222
AgsI TTSAA 3 cut(s) 7, 31, 64
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AsuHPI GGTGA 1 cut(s) 200
BccI CCATC 2 cut(s) 74, 100
BfuAI ACCTGC 1 cut(s) 176
BmsI GCATC 1 cut(s) 151
BoxI GACNNNNGTC 1 cut(s) 203
BsaJI CCNNGG 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 152
BseDI CCNNGG 1 cut(s) 23
BseNI ACTGG 1 cut(s) 152
BseRI GAGGAG 1 cut(s) 116
BspMI ACCTGC 1 cut(s) 176
BsrI ACTGG 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 23
Bst4CI ACNGT 1 cut(s) 20
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstPAI GACNNNNGTC 1 cut(s) 203
BtsIMutI CAGTG 1 cut(s) 16
BveI ACCTGC 1 cut(s) 176
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 222
FaiI YATR 3 cut(s) 122, 130, 209
HindIII AAGCTT 1 cut(s) 138
HphI GGTGA 1 cut(s) 200
Hpy166II GTNNAC 1 cut(s) 14
Hpy8I GTNNAC 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4V TGCA 2 cut(s) 124, 185
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
LpnPI CCDG 3 cut(s) 39, 165, 171
LweI GCATC 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 49
MluCI AATT 1 cut(s) 125
MnlI CCTC 2 cut(s) 33, 94
MslI CAYNNNNRTG 1 cut(s) 40
MwoI GCNNNNNNNGC 1 cut(s) 146
PaqCI CACCTGC 1 cut(s) 176
PshAI GACNNNNGTC 1 cut(s) 203
RseI CAYNNNNRTG 1 cut(s) 40
SetI ASST 2 cut(s) 142, 190
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 9 cut(s) 36, 58, 66, 99, 109, 153, 164, 177, 198
SmiMI CAYNNNNRTG 1 cut(s) 40
Sse9I AATT 1 cut(s) 125
TaaI ACNGT 1 cut(s) 20
TasI AATT 1 cut(s) 125
TscAI CASTG 1 cut(s) 23
TspRI CASTG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.