Rh5CG232700

Protein kinase PVPK-1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
24143097 .. 24144040
944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG232700.1

Sequence Viewer

Length: 693 bp
ATGATGAATAATGCTCAAGCACCACAAAATGGTTTCAAGCCAACATCATTCACCGGCATGAATCAAATGTCAGTTAATAACCCACATCAGTCTACATATGGTTTCATGGCTCAAAATGGTGCTGCATACGCTCATTTGACAACTGGGACTTCTCGTCCCTCTCAGCCTCCATCTCCGAAACAATTGAGAAGTGAAGTGGCTTCATCCACATCTAGTGTGGCAGCTCATGCTTATGAAGTAAAGACAATAGGCTATTCAAATGGTTCTGTAATTAATCCCAACGCAGTATCTTACCATGGCGCACTGCAGGAAGATTTACTCAGTATGGGGAAACGGTACCAGAGTTCAAATAAAGGCAAAGTTGAACATGGAGGCTCAAATGAGGAATTTGATTCAAACAGCTTTCCAGAATCTAGGAATTATGTTGTAGGTCCAGGTGTAGGAGTTGCTGGACGGGAAAATGGCCACTTAGTTTCTCATTCCGGAGTAGGGACTGCCTTTTGTCCAAGCCCTCAGAATAGCTTATATTCTGCTGCCCCCACTCTATATTGTGAAGCCAAACAGAGTTTTACCAATACAGAAGTCAATGAATGTACAAGCAGCATTGAGAAGTCTGCTGAAACTGAAAGTGAGTTCACTAATTCCTGTGAGCTGATTGAGAGCAGAAAGACCAAATATCGGTTCATGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

230

Amino Acids

24.77

Weight (kDa)

6.38

Isoelectric Point (pI)

54.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 336
AccB1I GGYRCC 1 cut(s) 336
AccB7I CCANNNNNTGG 1 cut(s) 29
AccI GTMKAC 1 cut(s) 92
AccIII TCCGGA 1 cut(s) 482
AcoI YGGCCR 1 cut(s) 463
AcsI RAATTY 1 cut(s) 386
AfaI GTAC 2 cut(s) 338, 595
AfiI CCNNNNNNNGG 4 cut(s) 29, 440, 489, 678
AgsI TTSAA 5 cut(s) 37, 258, 348, 365, 396
AhdI GACNNNNNGTC 1 cut(s) 153
AjnI CCWGG 1 cut(s) 433
AjuI GAANNNNNNNTTGG 1 cut(s) 665
AluBI AGCT 4 cut(s) 224, 402, 522, 652
AluI AGCT 4 cut(s) 224, 402, 522, 652
Aor13HI TCCGGA 1 cut(s) 482
AoxI GGCC 1 cut(s) 463
ApeKI GCWGC 4 cut(s) 122, 221, 533, 600
ApoI RAATTY 1 cut(s) 386
AseI ATTAAT 1 cut(s) 273
Asp718I GGTACC 1 cut(s) 336
AspLEI GCGC 1 cut(s) 302
AspS9I GGNCC 1 cut(s) 431
AsuHPI GGTGA 1 cut(s) 43
AvaII GGWCC 1 cut(s) 431
BaeI ACNNNNGTAYC 2 cut(s) 328, 361
BalI TGGCCA 1 cut(s) 465
BanI GGYRCC 1 cut(s) 336
BbvI GCAGC 4 cut(s) 109, 233, 520, 612
BccI CCATC 1 cut(s) 178
BciT130I CCWGG 1 cut(s) 435
BfaI CTAG 3 cut(s) 213, 414, 691
BfmI CTRYAG 1 cut(s) 305
BisI GCNGC 4 cut(s) 123, 222, 534, 601
BlsI GCNGC 4 cut(s) 124, 223, 535, 602
Bme1390I CCNGG 1 cut(s) 435
Bme18I GGWCC 1 cut(s) 431
BmeRI GACNNNNNGTC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 431
BmiI GGNNCC 1 cut(s) 338
BmrFI CCNGG 1 cut(s) 435
BmrI ACTGGG 1 cut(s) 153
BmuI ACTGGG 1 cut(s) 153
BsaJI CCNNGG 1 cut(s) 295
BsaWI WCCGGW 1 cut(s) 482
Bsc4I CCNNNNNNNGG 4 cut(s) 29, 440, 489, 678
Bse118I RCCGGY 1 cut(s) 53
Bse1I ACTGG 1 cut(s) 148
BseAI TCCGGA 1 cut(s) 482
BseBI CCWGG 1 cut(s) 435
BseDI CCNNGG 1 cut(s) 295
BseGI GGATG 1 cut(s) 203
BseLI CCNNNNNNNGG 4 cut(s) 29, 440, 489, 678
BseMII CTCAG 3 cut(s) 176, 334, 527
BseNI ACTGG 1 cut(s) 148
BseXI GCAGC 4 cut(s) 109, 233, 520, 612
BshFI GGCC 1 cut(s) 465
BshNI GGYRCC 1 cut(s) 336
BsiSI CCGG 2 cut(s) 54, 483
BslFI GGGAC 3 cut(s) 141, 160, 505
BslI CCNNNNNNNGG 4 cut(s) 29, 440, 489, 678
BsmFI GGGAC 3 cut(s) 141, 160, 505
BsnI GGCC 1 cut(s) 465
Bsp13I TCCGGA 1 cut(s) 482
Bsp1407I TGTACA 1 cut(s) 593
Bsp19I CCATGG 1 cut(s) 295
BspANI GGCC 1 cut(s) 465
BspCNI CTCAG 3 cut(s) 175, 333, 526
BspEI TCCGGA 1 cut(s) 482
BspLI GGNNCC 1 cut(s) 338
BspMAI CTGCAG 1 cut(s) 309
BspT107I GGYRCC 1 cut(s) 336
BsrFI RCCGGY 1 cut(s) 53
BsrGI TGTACA 1 cut(s) 593
BsrI ACTGG 1 cut(s) 148
BssAI RCCGGY 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 295
BssT1I CCWWGG 1 cut(s) 295
Bst2UI CCWGG 1 cut(s) 435
Bst4CI ACNGT 1 cut(s) 336
BstAPI GCANNNNNTGC 1 cut(s) 227
BstAUI TGTACA 1 cut(s) 593
BstDEI CTNAG 4 cut(s) 162, 320, 469, 513
BstDSI CCRYGG 1 cut(s) 295
BstF5I GGATG 1 cut(s) 203
BstHHI GCGC 1 cut(s) 302
BstMWI GCNNNNNNNGC 2 cut(s) 128, 227
BstNI CCWGG 1 cut(s) 435
BstSCI CCNGG 1 cut(s) 433
BstSFI CTRYAG 1 cut(s) 305
BstV1I GCAGC 4 cut(s) 109, 233, 520, 612
BsuRI GGCC 1 cut(s) 465
BtgI CCRYGG 1 cut(s) 295
BtsCI GGATG 1 cut(s) 203
BtsI GCAGTG 1 cut(s) 302
BtsIMutI CAGTG 1 cut(s) 302
CfoI GCGC 1 cut(s) 302
Cfr10I RCCGGY 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 431
Csp6I GTAC 2 cut(s) 337, 594
CviAII CATG 6 cut(s) 58, 106, 227, 296, 368, 685
CviQI GTAC 2 cut(s) 337, 594
DdeI CTNAG 4 cut(s) 162, 320, 469, 513
DriI GACNNNNNGTC 1 cut(s) 153
EaeI YGGCCR 1 cut(s) 463
Eam1105I GACNNNNNGTC 1 cut(s) 153
Eco130I CCWWGG 1 cut(s) 295
Eco47I GGWCC 1 cut(s) 431
EcoRII CCWGG 1 cut(s) 433
EcoT14I CCWWGG 1 cut(s) 295
ErhI CCWWGG 1 cut(s) 295
FaeI CATG 6 cut(s) 61, 109, 230, 299, 371, 688
FaqI GGGAC 3 cut(s) 141, 160, 505
FatI CATG 6 cut(s) 57, 105, 226, 295, 367, 684
FauNDI CATATG 1 cut(s) 97
FblI GTMKAC 1 cut(s) 92
Fnu4HI GCNGC 4 cut(s) 123, 222, 534, 601
FokI GGATG 1 cut(s) 190
Fsp4HI GCNGC 4 cut(s) 123, 222, 534, 601
FspBI CTAG 3 cut(s) 213, 414, 691
GlaI GCGC 1 cut(s) 301
GluI GCNGC 4 cut(s) 123, 222, 534, 601
HaeIII GGCC 1 cut(s) 465
HapII CCGG 2 cut(s) 54, 483
HhaI GCGC 1 cut(s) 302
Hin1II CATG 6 cut(s) 61, 109, 230, 299, 371, 688
Hin6I GCGC 1 cut(s) 300
HinP1I GCGC 1 cut(s) 300
HinfI GANTC 3 cut(s) 61, 392, 410
HpaII CCGG 2 cut(s) 54, 483
HphI GGTGA 1 cut(s) 43
Hpy166II GTNNAC 2 cut(s) 93, 636
Hpy188I TCNGA 2 cut(s) 177, 516
Hpy188III TCNNGA 2 cut(s) 407, 483
Hpy8I GTNNAC 2 cut(s) 93, 636
HpyCH4III ACNGT 1 cut(s) 336
HpyCH4V TGCA 2 cut(s) 125, 307
HpyF10VI GCNNNNNNNGC 2 cut(s) 128, 227
HpyF3I CTNAG 4 cut(s) 162, 320, 469, 513
Hsp92II CATG 6 cut(s) 61, 109, 230, 299, 371, 688
HspAI GCGC 1 cut(s) 300
Kpn2I TCCGGA 1 cut(s) 482
KpnI GGTACC 1 cut(s) 340
Lsp1109I GCAGC 4 cut(s) 109, 233, 520, 612
MaeI CTAG 3 cut(s) 213, 414, 691
MboII GAAGA 1 cut(s) 323
MfeI CAATTG 1 cut(s) 182
MlsI TGGCCA 1 cut(s) 465
MluCI AATT 5 cut(s) 182, 270, 386, 418, 640
MluNI TGGCCA 1 cut(s) 465
MnlI CCTC 5 cut(s) 169, 177, 365, 376, 522
Mox20I TGGCCA 1 cut(s) 465
MroI TCCGGA 1 cut(s) 482
MscI TGGCCA 1 cut(s) 465
MseI TTAA 2 cut(s) 75, 273
MslI CAYNNNNRTG 2 cut(s) 56, 231
Msp20I TGGCCA 1 cut(s) 465
MspI CCGG 2 cut(s) 54, 483
MspR9I CCNGG 1 cut(s) 435
MunI CAATTG 1 cut(s) 182
MvaI CCWGG 1 cut(s) 435
MwoI GCNNNNNNNGC 2 cut(s) 128, 227
NcoI CCATGG 1 cut(s) 295
NdeI CATATG 1 cut(s) 97
NlaIII CATG 6 cut(s) 61, 109, 230, 299, 371, 688
NlaIV GGNNCC 1 cut(s) 338
PfeI GAWTC 3 cut(s) 61, 392, 410
PflMI CCANNNNNTGG 1 cut(s) 29
PkrI GCNGC 4 cut(s) 124, 223, 535, 602
PshBI ATTAAT 1 cut(s) 273
Psp6I CCWGG 1 cut(s) 433
PspGI CCWGG 1 cut(s) 433
PspN4I GGNNCC 1 cut(s) 338
PspPI GGNCC 1 cut(s) 431
PstI CTGCAG 1 cut(s) 309
RsaI GTAC 2 cut(s) 338, 595
RsaNI GTAC 2 cut(s) 337, 594
RseI CAYNNNNRTG 2 cut(s) 56, 231
SaqAI TTAA 2 cut(s) 75, 273
SatI GCNGC 4 cut(s) 123, 222, 534, 601
Sau96I GGNCC 1 cut(s) 431
ScrFI CCNGG 1 cut(s) 435
SetI ASST 6 cut(s) 226, 404, 433, 439, 524, 654
SfcI CTRYAG 1 cut(s) 305
SinI GGWCC 1 cut(s) 431
SmiMI CAYNNNNRTG 2 cut(s) 56, 231
SmlI CTYRAG 1 cut(s) 15
SmoI CTYRAG 1 cut(s) 15
Sse9I AATT 5 cut(s) 182, 270, 386, 418, 640
SspMI CTAG 3 cut(s) 213, 414, 691
StyD4I CCNGG 1 cut(s) 433
StyI CCWWGG 1 cut(s) 295
TaaI ACNGT 1 cut(s) 336
TasI AATT 5 cut(s) 182, 270, 386, 418, 640
TatI WGTACW 1 cut(s) 593
TfiI GAWTC 3 cut(s) 61, 392, 410
Tru1I TTAA 2 cut(s) 75, 273
Tru9I TTAA 2 cut(s) 75, 273
TscAI CASTG 1 cut(s) 309
TseI GCWGC 4 cut(s) 122, 221, 533, 600
TspDTI ATGAA 7 cut(s) 20, 74, 94, 192, 249, 603, 673
TspRI CASTG 1 cut(s) 309
Van91I CCANNNNNTGG 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 431
VspI ATTAAT 1 cut(s) 273
XapI RAATTY 1 cut(s) 386
XcmI CCANNNNNNNNNTGG 1 cut(s) 214
XmiI GTMKAC 1 cut(s) 92
XspI CTAG 3 cut(s) 213, 414, 691
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.