Rh5CG324200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
35873523 .. 35873868
346 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG324200.1

Sequence Viewer

Length: 252 bp
ATGGAGGGAATTGGGGGAGGGAATGACGTCCTAAACGAGGTTGTGGAGGTGGGAGAGGCAGGAGTCACGGAGGTTTTGGAAAACGACGACAAAGGAGACGATGGTGACGAAGTCGTTGATGGAAGGGAATTGAATGGGAAGTTTGGTTGGATTTCTGCTCATTACATTGAGTACAAATATGGAGGGAATGATGGTCATTCCCTGTGGAAAATGGTGGGAAATCAAGGTCTGGTAAAGTCTGGGGTCATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.84

Weight (kDa)

4.22

Isoelectric Point (pI)

17.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 30
AcyI GRCGYC 1 cut(s) 27
AfaI GTAC 1 cut(s) 173
AfiI CCNNNNNNNGG 1 cut(s) 37
AgsI TTSAA 1 cut(s) 133
Alw26I GTCTC 1 cut(s) 90
AsuHPI GGTGA 1 cut(s) 116
BccI CCATC 3 cut(s) 95, 113, 185
BcoDI GTCTC 1 cut(s) 90
BsaHI GRCGYC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 37
BslI CCNNNNNNNGG 1 cut(s) 37
BsmAI GTCTC 1 cut(s) 90
BsmBI CGTCTC 1 cut(s) 90
BssNI GRCGYC 1 cut(s) 27
BstACI GRCGYC 1 cut(s) 27
BstENI CCTNNNNNAGG 1 cut(s) 35
BstMAI GTCTC 1 cut(s) 90
Csp6I GTAC 1 cut(s) 172
CviQI GTAC 1 cut(s) 172
EcoNI CCTNNNNNAGG 1 cut(s) 35
Esp3I CGTCTC 1 cut(s) 90
FaiI YATR 1 cut(s) 180
Hin1I GRCGYC 1 cut(s) 27
HinfI GANTC 1 cut(s) 63
HphI GGTGA 1 cut(s) 116
Hpy99I CGWCG 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 117
HpyCH4IV ACGT 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 27
Hsp92I GRCGYC 1 cut(s) 27
LpnPI CCDG 4 cut(s) 45, 215, 215, 225
MaeII ACGT 1 cut(s) 27
MaeIII GTNAC 2 cut(s) 64, 104
MluCI AATT 2 cut(s) 9, 128
MlyI GAGTC 1 cut(s) 72
MmeI TCCRAC 1 cut(s) 128
MnlI CCTC 6 cut(s) 11, 31, 40, 49, 64, 176
MseI TTAA 1 cut(s) 250
NmuCI GTSAC 2 cut(s) 64, 104
PcsI WCGNNNNNNNCGW 2 cut(s) 33, 105
PflFI GACNNNGTC 1 cut(s) 110
PleI GAGTC 1 cut(s) 71
PpsI GAGTC 1 cut(s) 71
PsyI GACNNNGTC 1 cut(s) 110
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
SaqAI TTAA 1 cut(s) 250
SchI GAGTC 1 cut(s) 72
SetI ASST 5 cut(s) 30, 42, 51, 75, 229
SgeI CNNG 6 cut(s) 49, 72, 79, 214, 236, 242
Sse9I AATT 2 cut(s) 9, 128
TaiI ACGT 1 cut(s) 30
TasI AATT 2 cut(s) 9, 128
TatI WGTACW 1 cut(s) 171
Tru1I TTAA 1 cut(s) 250
Tru9I TTAA 1 cut(s) 250
TseFI GTSAC 2 cut(s) 64, 104
Tsp45I GTSAC 2 cut(s) 64, 104
TspGWI ACGGA 1 cut(s) 83
Tth111I GACNNNGTC 1 cut(s) 110
XagI CCTNNNNNAGG 1 cut(s) 35
ZraI GACGTC 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.