Rh6CG150400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
19678637 .. 19681957
3321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG150400.1

Sequence Viewer

Length: 171 bp
ATGCTTAAACTTAGAGCTGAGGTCGTGGAGGTGGGAGAGGCAGGAGTCACAGTGGTTCTGGAAAACGACGACGGAGGGAATGGTGGTCCATCCCCTATGGAAAATGGCGGGAAATCAAGGTATAAAGTTCGAGCAAGCAAAGCCATCTTGCTCAAATCTAACAATTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.84

Weight (kDa)

8.1

Isoelectric Point (pI)

16.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 108
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 86
AvaII GGWCC 1 cut(s) 86
BbvCI CCTCAGC 1 cut(s) 18
BccI CCATC 2 cut(s) 97, 152
Bme18I GGWCC 1 cut(s) 86
BmgT120I GGNCC 1 cut(s) 86
Bpu10I CCTNAGC 1 cut(s) 18
BsaXI ACNNNNNCTCC 2 cut(s) 36, 66
BseGI GGATG 1 cut(s) 89
BseMII CTCAG 1 cut(s) 9
BspACI CCGC 1 cut(s) 108
BspCNI CTCAG 1 cut(s) 10
Bst4CI ACNGT 1 cut(s) 52
BstC8I GCNNGC 1 cut(s) 136
BstDEI CTNAG 2 cut(s) 11, 18
BstF5I GGATG 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 140
BtsCI GGATG 1 cut(s) 89
BtsIMutI CAGTG 1 cut(s) 57
Cac8I GCNNGC 1 cut(s) 136
Cfr13I GGNCC 1 cut(s) 86
CviJI RGCY 2 cut(s) 17, 143
CviKI_1 RGCY 2 cut(s) 17, 143
DdeI CTNAG 2 cut(s) 11, 18
Eco47I GGWCC 1 cut(s) 86
FaiI YATR 3 cut(s) 98, 123, 169
FauI CCCGC 1 cut(s) 101
FokI GGATG 1 cut(s) 76
HinfI GANTC 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 59
Hpy99I CGWCG 2 cut(s) 71, 74
HpyCH4III ACNGT 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpyF3I CTNAG 2 cut(s) 11, 18
LpnPI CCDG 2 cut(s) 27, 44
MaeIII GTNAC 1 cut(s) 46
MluCI AATT 1 cut(s) 163
MlyI GAGTC 1 cut(s) 54
MnlI CCTC 4 cut(s) 13, 22, 31, 68
MseI TTAA 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 140
NmuCI GTSAC 1 cut(s) 46
PleI GAGTC 1 cut(s) 53
PpsI GAGTC 1 cut(s) 53
PspPI GGNCC 1 cut(s) 86
SaqAI TTAA 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 86
SchI GAGTC 1 cut(s) 54
SetI ASST 4 cut(s) 19, 24, 33, 122
SgeI CNNG 8 cut(s) 37, 54, 71, 121, 129, 143, 147, 160
SinI GGWCC 1 cut(s) 86
Sse9I AATT 1 cut(s) 163
SsiI CCGC 1 cut(s) 108
TaaI ACNGT 1 cut(s) 52
TaqI TCGA 1 cut(s) 130
TasI AATT 1 cut(s) 163
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TscAI CASTG 1 cut(s) 57
TseFI GTSAC 1 cut(s) 46
Tsp45I GTSAC 1 cut(s) 46
TspDTI ATGAA 1 cut(s) 156
TspGWI ACGGA 1 cut(s) 87
TspRI CASTG 1 cut(s) 57
VpaK11BI GGWCC 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.