Rh5CG461000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
64329144 .. 64329803
660 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG461000.1

Sequence Viewer

Length: 183 bp
ATGCAGGAGCGGTTGCCTGAAGGATTGCCCTCTGATTGGCAGGCGATCAAAAAAACCCGAAAGAGTGGCAAATCTGCCGGGCAGGTTGATAAGATTCTTGATCGAAAGTTCGTAACTAATAAGACTAGTCTTTTCTCAATTTCGATCACTGCCAGAAGTGGAACAGTTTCTCGAAACACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.67

Weight (kDa)

10.67

Isoelectric Point (pI)

26.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 73
AccBSI CCGCTC 1 cut(s) 10
AciI CCGC 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 36
AhlI ACTAGT 1 cut(s) 125
Asp700I GAANNNNTTC 1 cut(s) 166
AsuC2I CCSGG 1 cut(s) 79
BcnI CCSGG 1 cut(s) 79
BcuI ACTAGT 1 cut(s) 125
BfaI CTAG 1 cut(s) 126
BfuAI ACCTGC 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 79
BmrFI CCNGG 1 cut(s) 79
BpuMI CCSGG 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 36
BsiSI CCGG 1 cut(s) 78
BslI CCNNNNNNNGG 1 cut(s) 36
Bsp143I GATC 3 cut(s) 45, 100, 144
BspACI CCGC 1 cut(s) 10
BspMI ACCTGC 1 cut(s) 73
BsrBI CCGCTC 1 cut(s) 10
BssMI GATC 3 cut(s) 45, 100, 144
Bst4CI ACNGT 1 cut(s) 166
BstC8I GCNNGC 1 cut(s) 42
BstKTI GATC 3 cut(s) 48, 103, 147
BstMBI GATC 3 cut(s) 45, 100, 144
BstSCI CCNGG 1 cut(s) 77
BtsI GCAGTG 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 147
BveI ACCTGC 1 cut(s) 73
Cac8I GCNNGC 1 cut(s) 42
DpnI GATC 3 cut(s) 47, 102, 146
DpnII GATC 3 cut(s) 45, 100, 144
Eco57I CTGAAG 1 cut(s) 39
FaiI YATR 1 cut(s) 181
FspBI CTAG 1 cut(s) 126
HapII CCGG 1 cut(s) 78
HinfI GANTC 1 cut(s) 94
HpaII CCGG 1 cut(s) 78
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 2 cut(s) 98, 171
HpyAV CCTTC 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 166
HpyCH4V TGCA 1 cut(s) 4
Kzo9I GATC 3 cut(s) 45, 100, 144
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 5 cut(s) 26, 30, 68, 91, 166
MaeI CTAG 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 112
MalI GATC 3 cut(s) 47, 102, 146
MbiI CCGCTC 1 cut(s) 10
MboI GATC 3 cut(s) 45, 100, 144
MluCI AATT 1 cut(s) 138
MnlI CCTC 1 cut(s) 40
MroXI GAANNNNTTC 1 cut(s) 166
MspI CCGG 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 79
NciI CCSGG 1 cut(s) 79
NdeII GATC 3 cut(s) 45, 100, 144
PdmI GAANNNNTTC 1 cut(s) 166
PfeI GAWTC 1 cut(s) 94
Sau3AI GATC 3 cut(s) 45, 100, 144
ScrFI CCNGG 1 cut(s) 79
SetI ASST 1 cut(s) 87
SpeI ACTAGT 1 cut(s) 125
Sse9I AATT 1 cut(s) 138
SsiI CCGC 1 cut(s) 10
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 77
TaaI ACNGT 1 cut(s) 166
TaqI TCGA 3 cut(s) 103, 143, 172
TasI AATT 1 cut(s) 138
TfiI GAWTC 1 cut(s) 94
TscAI CASTG 1 cut(s) 154
TspRI CASTG 1 cut(s) 154
XmnI GAANNNNTTC 1 cut(s) 166
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.