Rh5DG543300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
83594952 .. 83595200
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG543300.1

Sequence Viewer

Length: 249 bp
ATGGCCCAATACAGATCAGCCCAGCCCGAACGCAGGAAATCTCCAGCCTCTGCTACCGTCGGAACCTCCTTGAGCCGCCCCTCAGAACCTTCACCAAGACTACCATCAGTTGCCGATCAAGGCCAAAACCACCAGCCTAACCCTCCACAGCCATCGAAGCCTCCTCTTCCAGATCCACAGCCCACCACACTTTACATCAACCAGCCCCTGGAACAGCTCACTGAAAACCCGATTGAGGATCCGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

8.97

Weight (kDa)

5.66

Isoelectric Point (pI)

85.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018110)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 208
AciI CCGC 1 cut(s) 76
AclWI GGATC 3 cut(s) 167, 233, 246
AfiI CCNNNNNNNGG 3 cut(s) 33, 208, 235
AjnI CCWGG 1 cut(s) 207
AluBI AGCT 1 cut(s) 217
AluI AGCT 1 cut(s) 217
AlwI GGATC 3 cut(s) 167, 233, 246
AlwNI CAGNNNCTG 2 cut(s) 50, 208
AoxI GGCC 2 cut(s) 3, 121
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 84
BamHI GGATCC 1 cut(s) 238
BccI CCATC 2 cut(s) 112, 160
BciT130I CCWGG 1 cut(s) 209
BisI GCNGC 1 cut(s) 76
BlsI GCNGC 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 2 cut(s) 64, 240
BmrFI CCNGG 1 cut(s) 209
BpmI CTGGAG 1 cut(s) 27
BpuEI CTTGAG 1 cut(s) 91
BsaJI CCNNGG 1 cut(s) 207
Bsc4I CCNNNNNNNGG 3 cut(s) 33, 208, 235
BseBI CCWGG 1 cut(s) 209
BseDI CCNNGG 1 cut(s) 207
BseLI CCNNNNNNNGG 3 cut(s) 33, 208, 235
BseMII CTCAG 1 cut(s) 96
BseRI GAGGAG 1 cut(s) 153
BseYI CCCAGC 1 cut(s) 21
BshFI GGCC 2 cut(s) 5, 123
BslI CCNNNNNNNGG 3 cut(s) 33, 208, 235
BsnI GGCC 2 cut(s) 5, 123
Bsp143I GATC 5 cut(s) 14, 115, 172, 238, 243
BspACI CCGC 1 cut(s) 76
BspANI GGCC 2 cut(s) 5, 123
BspCNI CTCAG 1 cut(s) 95
BspLI GGNNCC 2 cut(s) 64, 240
BspPI GGATC 3 cut(s) 167, 233, 246
BssECI CCNNGG 1 cut(s) 207
BssMI GATC 5 cut(s) 14, 115, 172, 238, 243
Bst2UI CCWGG 1 cut(s) 209
Bst4CI ACNGT 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 82
BstKTI GATC 5 cut(s) 17, 118, 175, 241, 246
BstMBI GATC 5 cut(s) 14, 115, 172, 238, 243
BstMWI GCNNNNNNNGC 1 cut(s) 157
BstNI CCWGG 1 cut(s) 209
BstSCI CCNGG 1 cut(s) 207
BstX2I RGATCY 2 cut(s) 172, 238
BstYI RGATCY 2 cut(s) 172, 238
BsuRI GGCC 2 cut(s) 5, 123
BtsIMutI CAGTG 1 cut(s) 219
CaiI CAGNNNCTG 2 cut(s) 50, 208
Cfr13I GGNCC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 82
DpnI GATC 5 cut(s) 16, 117, 174, 240, 245
DpnII GATC 5 cut(s) 14, 115, 172, 238, 243
Eam1104I CTCTTC 1 cut(s) 171
EarI CTCTTC 1 cut(s) 171
EcoRII CCWGG 1 cut(s) 207
Fnu4HI GCNGC 1 cut(s) 76
Fsp4HI GCNGC 1 cut(s) 76
GluI GCNGC 1 cut(s) 76
GsaI CCCAGC 1 cut(s) 25
GsuI CTGGAG 1 cut(s) 27
HaeIII GGCC 2 cut(s) 5, 123
HphI GGTGA 1 cut(s) 84
Hpy188I TCNGA 4 cut(s) 62, 85, 243, 248
Hpy188III TCNNGA 1 cut(s) 170
Hpy99I CGWCG 1 cut(s) 62
HpyAV CCTTC 1 cut(s) 99
HpyCH4III ACNGT 1 cut(s) 58
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
HpyF3I CTNAG 1 cut(s) 82
Kzo9I GATC 5 cut(s) 14, 115, 172, 238, 243
LpnPI CCDG 8 cut(s) 19, 35, 57, 146, 183, 194, 215, 221
MalI GATC 5 cut(s) 16, 117, 174, 240, 245
MboI GATC 5 cut(s) 14, 115, 172, 238, 243
MboII GAAGA 1 cut(s) 158
MflI RGATCY 2 cut(s) 172, 238
MmeI TCCRAC 1 cut(s) 40
MnlI CCTC 7 cut(s) 58, 76, 91, 153, 171, 174, 229
MspR9I CCNGG 1 cut(s) 209
MvaI CCWGG 1 cut(s) 209
MwoI GCNNNNNNNGC 1 cut(s) 157
NdeII GATC 5 cut(s) 14, 115, 172, 238, 243
NlaIV GGNNCC 2 cut(s) 64, 240
PflMI CCANNNNNTGG 1 cut(s) 208
PkrI GCNGC 1 cut(s) 77
Psp6I CCWGG 1 cut(s) 207
PspFI CCCAGC 1 cut(s) 21
PspGI CCWGG 1 cut(s) 207
PspN4I GGNNCC 2 cut(s) 64, 240
PspPI GGNCC 1 cut(s) 4
PstNI CAGNNNCTG 2 cut(s) 50, 208
PsuI RGATCY 2 cut(s) 172, 238
SatI GCNGC 1 cut(s) 76
Sau3AI GATC 5 cut(s) 14, 115, 172, 238, 243
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 209
SetI ASST 3 cut(s) 68, 91, 219
SmlI CTYRAG 1 cut(s) 70
SmoI CTYRAG 1 cut(s) 70
SsiI CCGC 1 cut(s) 76
StyD4I CCNGG 1 cut(s) 207
TaaI ACNGT 1 cut(s) 58
TaqI TCGA 1 cut(s) 155
TauI GCSGC 1 cut(s) 78
TscAI CASTG 1 cut(s) 226
TspRI CASTG 1 cut(s) 226
Van91I CCANNNNNTGG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.