Rh6CG272200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
44648140 .. 44648747
608 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG272200.1

Sequence Viewer

Length: 426 bp
ATGGATCCTCCACGTGGATGCAGGTCATGGAGGCCGTGCTTACTTCACCATCCCCACCACCATCTTCACCATCACCATCATCACCACCCCTTATTCCTCAACTCTCACCACCACCCCCACCACCACCACCATCACCACCACCATGTTCGCCCCTATTTCACATCTTTTGCTCAAAACCCAGAACATGCTACTCCCGTTCCTTTCCCAACCTATTCAAATTCGGAAACTTATGGGCTCAAAGGCGCTTACGATTACAATCCTATCCCCCAGGTATTGCAGGAGCAGAAGCATGATGATGTTGCGTTAGAAGAGGAAGAGGATGATGACCCAATTTTCGTCTTAACTGATGAATGGAAAGAATTTTTCGCGAAATCTGAAGCTAAGAGGAAACTAGAGAGGAAGCAAGCTAAAAAGGGAAAGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

141

Amino Acids

16.89

Weight (kDa)

6.96

Isoelectric Point (pI)

39.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 12
AccII CGCG 1 cut(s) 368
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 2 cut(s) 217, 359
AcuI CTGAAG 1 cut(s) 396
AcvI CACGTG 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 14
AgsI TTSAA 1 cut(s) 216
AjnI CCWGG 1 cut(s) 267
AluBI AGCT 2 cut(s) 380, 407
AluI AGCT 2 cut(s) 380, 407
AlwI GGATC 1 cut(s) 12
AoxI GGCC 1 cut(s) 32
ApoI RAATTY 2 cut(s) 217, 359
ArsI GACNNNNNNTTYG 2 cut(s) 317, 349
AspLEI GCGC 1 cut(s) 245
AsuHPI GGTGA 6 cut(s) 38, 59, 65, 74, 98, 125
BamHI GGATCC 1 cut(s) 4
BanII GRGCYC 1 cut(s) 237
BbrPI CACGTG 1 cut(s) 14
BccI CCATC 5 cut(s) 57, 69, 78, 84, 138
BceAI ACGGC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 269
BfaI CTAG 1 cut(s) 392
BfoI RGCGCY 1 cut(s) 246
BfuAI ACCTGC 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 269
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 269
BmsI GCATC 1 cut(s) 8
BsaAI YACGTR 1 cut(s) 14
BsaBI GATNNNNATC 1 cut(s) 255
BsaJI CCNNGG 1 cut(s) 267
Bsc4I CCNNNNNNNGG 1 cut(s) 14
Bse8I GATNNNNATC 1 cut(s) 255
BseBI CCWGG 1 cut(s) 269
BseDI CCNNGG 1 cut(s) 267
BseGI GGATG 3 cut(s) 23, 49, 325
BseJI GATNNNNATC 1 cut(s) 255
BseLI CCNNNNNNNGG 1 cut(s) 14
Bsh1236I CGCG 1 cut(s) 368
BshFI GGCC 1 cut(s) 34
BslI CCNNNNNNNGG 1 cut(s) 14
BsnI GGCC 1 cut(s) 34
Bsp1286I GDGCHC 1 cut(s) 237
Bsp143I GATC 1 cut(s) 4
Bsp68I TCGCGA 1 cut(s) 368
BspANI GGCC 1 cut(s) 34
BspFNI CGCG 1 cut(s) 368
BspLI GGNNCC 1 cut(s) 6
BspMI ACCTGC 1 cut(s) 12
BspPI GGATC 1 cut(s) 12
BssECI CCNNGG 1 cut(s) 267
BssMI GATC 1 cut(s) 4
Bst2UI CCWGG 1 cut(s) 269
Bst6I CTCTTC 2 cut(s) 303, 309
BstBAI YACGTR 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 405
BstDEI CTNAG 1 cut(s) 381
BstF5I GGATG 3 cut(s) 23, 49, 325
BstFNI CGCG 1 cut(s) 368
BstH2I RGCGCY 1 cut(s) 246
BstHHI GCGC 1 cut(s) 245
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstNI CCWGG 1 cut(s) 269
BstNSI RCATGY 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 267
BstUI CGCG 1 cut(s) 368
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 34
BtsCI GGATG 3 cut(s) 23, 49, 325
BtuMI TCGCGA 1 cut(s) 368
BveI ACCTGC 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 405
CfoI GCGC 1 cut(s) 245
CviAII CATG 4 cut(s) 27, 143, 185, 290
CviJI RGCY 4 cut(s) 34, 235, 380, 407
CviKI_1 RGCY 4 cut(s) 34, 235, 380, 407
DdeI CTNAG 1 cut(s) 381
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eam1104I CTCTTC 2 cut(s) 303, 309
EarI CTCTTC 2 cut(s) 303, 309
Eco24I GRGCYC 1 cut(s) 237
Eco57I CTGAAG 1 cut(s) 396
Eco72I CACGTG 1 cut(s) 14
EcoRII CCWGG 1 cut(s) 267
EcoT38I GRGCYC 1 cut(s) 237
FaeI CATG 4 cut(s) 30, 146, 188, 293
FaiI YATR 5 cut(s) 28, 144, 186, 231, 291
FatI CATG 4 cut(s) 26, 142, 184, 289
FokI GGATG 3 cut(s) 30, 36, 332
FriOI GRGCYC 1 cut(s) 237
FspBI CTAG 1 cut(s) 392
GlaI GCGC 1 cut(s) 244
HaeII RGCGCY 1 cut(s) 246
HaeIII GGCC 1 cut(s) 34
HhaI GCGC 1 cut(s) 245
Hin1II CATG 4 cut(s) 30, 146, 188, 293
Hin6I GCGC 1 cut(s) 243
HinP1I GCGC 1 cut(s) 243
HphI GGTGA 6 cut(s) 38, 59, 65, 74, 98, 125
Hpy188I TCNGA 2 cut(s) 223, 376
Hpy188III TCNNGA 1 cut(s) 367
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 2 cut(s) 21, 277
HpyF3I CTNAG 1 cut(s) 381
HpySE526I ACGT 1 cut(s) 13
Hsp92II CATG 4 cut(s) 30, 146, 188, 293
HspAI GCGC 1 cut(s) 243
Kzo9I GATC 1 cut(s) 4
LmnI GCTCC 1 cut(s) 280
LpnPI CCDG 5 cut(s) 7, 192, 254, 263, 281
LweI GCATC 1 cut(s) 8
MaeI CTAG 1 cut(s) 392
MaeII ACGT 1 cut(s) 13
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MboII GAAGA 3 cut(s) 56, 320, 326
MflI RGATCY 1 cut(s) 4
MhlI GDGCHC 1 cut(s) 237
MluCI AATT 3 cut(s) 217, 330, 359
MnlI CCTC 7 cut(s) 18, 24, 107, 304, 310, 378, 390
MseI TTAA 1 cut(s) 341
MslI CAYNNNNRTG 3 cut(s) 16, 141, 294
MspR9I CCNGG 1 cut(s) 269
MvaI CCWGG 1 cut(s) 269
MvnI CGCG 1 cut(s) 368
NdeII GATC 1 cut(s) 4
NlaIII CATG 4 cut(s) 30, 146, 188, 293
NlaIV GGNNCC 1 cut(s) 6
NruI TCGCGA 1 cut(s) 368
NspI RCATGY 1 cut(s) 188
PmaCI CACGTG 1 cut(s) 14
PmlI CACGTG 1 cut(s) 14
Ppu21I YACGTR 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 267
PspCI CACGTG 1 cut(s) 14
PspGI CCWGG 1 cut(s) 267
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 4
RruI TCGCGA 1 cut(s) 368
RseI CAYNNNNRTG 3 cut(s) 16, 141, 294
SaqAI TTAA 1 cut(s) 341
Sau3AI GATC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 269
SduI GDGCHC 1 cut(s) 237
SetI ASST 6 cut(s) 16, 26, 212, 273, 382, 409
SfaNI GCATC 1 cut(s) 8
SmiMI CAYNNNNRTG 3 cut(s) 16, 141, 294
Sse9I AATT 3 cut(s) 217, 330, 359
SspMI CTAG 1 cut(s) 392
StyD4I CCNGG 1 cut(s) 267
TaiI ACGT 1 cut(s) 16
TasI AATT 3 cut(s) 217, 330, 359
Tru1I TTAA 1 cut(s) 341
Tru9I TTAA 1 cut(s) 341
TspDTI ATGAA 1 cut(s) 363
XapI RAATTY 2 cut(s) 217, 359
XceI RCATGY 1 cut(s) 188
XspI CTAG 1 cut(s) 392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.