Rw0G008300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00313
OG0010525
Physical Location & Seq
Forward (+)
18569 .. 19177
609 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G008300.1

Sequence Viewer

Length: 441 bp
ATGGATCCTCCACATGGATGCAGGTCATGGAGGCCGTGCTTACTTCACCATCCCCACCACCATCTTCACCATCACCATCATCACCACCCCTTATTCCTCAACCCTCACCACCACCCCCACCACCACCACCACCACTTCAACTGCCGCCACCACCATGTTCGCCCCAATTTCGCATCTTTTGGTCAAAACCCAGAACAAGCTACCCCGTTCCTTTCCCAACCTATTCAAAGTCGGAAACTTCTGGGATCAAAGGCGCGTACGATTACAATCCTACCCCCCTGTAAGGTATTGCAGGAGCAGAATCATGACGATGTTGCGTTAGAGGAGGAAGAGGATGATGACCCAATTTTCGTCTTAACTGATGAATGGAAAGAATTTTTCGCGAAATCTGAAGCTAAGAGGAAACTAGAGAGGAAGCAAGCTAAAAAGGGAAAGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

17.36

Weight (kDa)

8.74

Isoelectric Point (pI)

43.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 12
AccII CGCG 2 cut(s) 256, 383
AciI CCGC 1 cut(s) 145
AclWI GGATC 2 cut(s) 12, 253
AcsI RAATTY 1 cut(s) 374
AcuI CTGAAG 1 cut(s) 411
AfaI GTAC 1 cut(s) 259
AfiI CCNNNNNNNGG 2 cut(s) 14, 283
AgsI TTSAA 2 cut(s) 139, 227
AluBI AGCT 3 cut(s) 200, 395, 422
AluI AGCT 3 cut(s) 200, 395, 422
AlwI GGATC 2 cut(s) 12, 253
AoxI GGCC 1 cut(s) 32
ApoI RAATTY 1 cut(s) 374
ArsI GACNNNNNNTTYG 2 cut(s) 332, 364
AspLEI GCGC 1 cut(s) 256
AsuHPI GGTGA 5 cut(s) 38, 59, 65, 74, 98
BamHI GGATCC 1 cut(s) 4
BccI CCATC 4 cut(s) 57, 69, 78, 84
BceAI ACGGC 1 cut(s) 19
BfaI CTAG 1 cut(s) 407
BfuAI ACCTGC 1 cut(s) 12
BisI GCNGC 1 cut(s) 145
BlsI GCNGC 1 cut(s) 146
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 2 cut(s) 8, 182
BsaBI GATNNNNATC 1 cut(s) 266
Bsc4I CCNNNNNNNGG 2 cut(s) 14, 283
Bse8I GATNNNNATC 1 cut(s) 266
BseGI GGATG 3 cut(s) 23, 49, 340
BseJI GATNNNNATC 1 cut(s) 266
BseLI CCNNNNNNNGG 2 cut(s) 14, 283
BseRI GAGGAG 1 cut(s) 338
Bsh1236I CGCG 2 cut(s) 256, 383
BshFI GGCC 1 cut(s) 34
BsiWI CGTACG 1 cut(s) 257
BslI CCNNNNNNNGG 2 cut(s) 14, 283
BsnI GGCC 1 cut(s) 34
Bsp143I GATC 2 cut(s) 4, 245
Bsp68I TCGCGA 1 cut(s) 383
BspACI CCGC 1 cut(s) 145
BspANI GGCC 1 cut(s) 34
BspFNI CGCG 2 cut(s) 256, 383
BspHI TCATGA 1 cut(s) 304
BspLI GGNNCC 1 cut(s) 6
BspMI ACCTGC 1 cut(s) 12
BspPI GGATC 2 cut(s) 12, 253
BssMI GATC 2 cut(s) 4, 245
Bst6I CTCTTC 1 cut(s) 324
BstC8I GCNNGC 1 cut(s) 420
BstDEI CTNAG 1 cut(s) 396
BstF5I GGATG 3 cut(s) 23, 49, 340
BstFNI CGCG 2 cut(s) 256, 383
BstHHI GCGC 1 cut(s) 256
BstKTI GATC 2 cut(s) 7, 248
BstMBI GATC 2 cut(s) 4, 245
BstUI CGCG 2 cut(s) 256, 383
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 34
BtsCI GGATG 3 cut(s) 23, 49, 340
BtuMI TCGCGA 1 cut(s) 383
BveI ACCTGC 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 420
CciI TCATGA 1 cut(s) 304
CfoI GCGC 1 cut(s) 256
Csp6I GTAC 1 cut(s) 258
CviAII CATG 4 cut(s) 14, 27, 155, 305
CviJI RGCY 4 cut(s) 34, 200, 395, 422
CviKI_1 RGCY 4 cut(s) 34, 200, 395, 422
CviQI GTAC 1 cut(s) 258
DdeI CTNAG 1 cut(s) 396
DpnI GATC 2 cut(s) 6, 247
DpnII GATC 2 cut(s) 4, 245
Eam1104I CTCTTC 1 cut(s) 324
EarI CTCTTC 1 cut(s) 324
Eco57I CTGAAG 1 cut(s) 411
FaeI CATG 4 cut(s) 17, 30, 158, 308
FaiI YATR 4 cut(s) 15, 28, 156, 306
FatI CATG 4 cut(s) 13, 26, 154, 304
Fnu4HI GCNGC 1 cut(s) 145
FokI GGATG 3 cut(s) 30, 36, 347
Fsp4HI GCNGC 1 cut(s) 145
FspBI CTAG 1 cut(s) 407
GlaI GCGC 1 cut(s) 255
GluI GCNGC 1 cut(s) 145
HaeIII GGCC 1 cut(s) 34
HhaI GCGC 1 cut(s) 256
Hin1II CATG 4 cut(s) 17, 30, 158, 308
Hin6I GCGC 1 cut(s) 254
HinP1I GCGC 1 cut(s) 254
HinfI GANTC 1 cut(s) 301
HphI GGTGA 5 cut(s) 38, 59, 65, 74, 98
Hpy188I TCNGA 2 cut(s) 234, 391
Hpy188III TCNNGA 2 cut(s) 305, 382
HpyCH4V TGCA 2 cut(s) 21, 292
HpyF3I CTNAG 1 cut(s) 396
Hsp92II CATG 4 cut(s) 17, 30, 158, 308
HspAI GCGC 1 cut(s) 254
Kzo9I GATC 2 cut(s) 4, 245
LmnI GCTCC 1 cut(s) 295
LpnPI CCDG 5 cut(s) 7, 204, 227, 278, 292
LweI GCATC 2 cut(s) 8, 182
MaeI CTAG 1 cut(s) 407
MalI GATC 2 cut(s) 6, 247
MboI GATC 2 cut(s) 4, 245
MboII GAAGA 2 cut(s) 56, 341
MflI RGATCY 1 cut(s) 4
MluCI AATT 3 cut(s) 166, 345, 374
MmeI TCCRAC 1 cut(s) 212
MnlI CCTC 9 cut(s) 18, 24, 107, 114, 316, 319, 325, 393, 405
MseI TTAA 1 cut(s) 356
MslI CAYNNNNRTG 3 cut(s) 16, 153, 309
MvnI CGCG 2 cut(s) 256, 383
NdeII GATC 2 cut(s) 4, 245
NlaIII CATG 4 cut(s) 17, 30, 158, 308
NlaIV GGNNCC 1 cut(s) 6
NruI TCGCGA 1 cut(s) 383
PagI TCATGA 1 cut(s) 304
PfeI GAWTC 1 cut(s) 301
Pfl23II CGTACG 1 cut(s) 257
PkrI GCNGC 1 cut(s) 146
PspLI CGTACG 1 cut(s) 257
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 4
RruI TCGCGA 1 cut(s) 383
RsaI GTAC 1 cut(s) 259
RsaNI GTAC 1 cut(s) 258
RseI CAYNNNNRTG 3 cut(s) 16, 153, 309
SaqAI TTAA 1 cut(s) 356
SatI GCNGC 1 cut(s) 145
Sau3AI GATC 2 cut(s) 4, 245
SetI ASST 6 cut(s) 26, 202, 223, 288, 397, 424
SfaNI GCATC 2 cut(s) 8, 182
SmiMI CAYNNNNRTG 3 cut(s) 16, 153, 309
Sse9I AATT 3 cut(s) 166, 345, 374
SsiI CCGC 1 cut(s) 145
SspMI CTAG 1 cut(s) 407
TasI AATT 3 cut(s) 166, 345, 374
TauI GCSGC 1 cut(s) 147
TfiI GAWTC 1 cut(s) 301
Tru1I TTAA 1 cut(s) 356
Tru9I TTAA 1 cut(s) 356
TspDTI ATGAA 1 cut(s) 378
XapI RAATTY 1 cut(s) 374
XspI CTAG 1 cut(s) 407
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.