Rh6DG454600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
62605990 .. 62610585
4596 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG454600.1

Sequence Viewer

Length: 225 bp
ATGGAAAGTTCCTCTGTCTTATTTGAGATTATCGTCCAGTCTGCTGGATTATCATCTCTGGTTTTGCTATGCGAAGAGGGGAAGGGAGAAGATGATCAAGAGAAGGACCTGGTTGGACGATTCATGAATGTATTTATGAATGTCAAGATATCAAGGTTTCCTCCTGTTTATTGTGGAATTCTGGAATGTGTTTTATTATGTGAAGTGAAGAGATCTGGATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.17

Weight (kDa)

4.61

Isoelectric Point (pI)

57.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 177
AjnI CCWGG 1 cut(s) 108
ApoI RAATTY 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BciT130I CCWGG 1 cut(s) 110
BclI TGATCA 1 cut(s) 94
BglII AGATCT 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 110
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmrFI CCNGG 1 cut(s) 110
BsaBI GATNNNNATC 2 cut(s) 52, 217
Bse1I ACTGG 1 cut(s) 37
Bse8I GATNNNNATC 2 cut(s) 52, 217
BseBI CCWGG 1 cut(s) 110
BseJI GATNNNNATC 2 cut(s) 52, 217
BseNI ACTGG 1 cut(s) 37
Bsp143I GATC 3 cut(s) 94, 212, 218
BspHI TCATGA 1 cut(s) 123
BsrI ACTGG 1 cut(s) 37
BssMI GATC 3 cut(s) 94, 212, 218
Bst2UI CCWGG 1 cut(s) 110
Bst6I CTCTTC 2 cut(s) 69, 203
BstKTI GATC 3 cut(s) 97, 215, 221
BstMBI GATC 3 cut(s) 94, 212, 218
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BstX2I RGATCY 1 cut(s) 212
BstXI CCANNNNNNTGG 1 cut(s) 44
BstYI RGATCY 1 cut(s) 212
CciI TCATGA 1 cut(s) 123
Cfr13I GGNCC 1 cut(s) 106
CsiI ACCWGGT 1 cut(s) 108
CviAII CATG 1 cut(s) 124
DpnI GATC 3 cut(s) 96, 214, 220
DpnII GATC 3 cut(s) 94, 212, 218
Eam1104I CTCTTC 2 cut(s) 69, 203
EarI CTCTTC 2 cut(s) 69, 203
Eco32I GATATC 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 106
EcoO109I RGGNCCY 1 cut(s) 106
EcoRI GAATTC 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 108
EcoRV GATATC 1 cut(s) 150
FaeI CATG 1 cut(s) 127
FaiI YATR 5 cut(s) 70, 125, 137, 199, 223
FatI CATG 1 cut(s) 123
FbaI TGATCA 1 cut(s) 94
Hin1II CATG 1 cut(s) 127
HinfI GANTC 1 cut(s) 120
Hpy188III TCNNGA 5 cut(s) 98, 124, 145, 182, 216
HpyAV CCTTC 2 cut(s) 76, 97
Hsp92II CATG 1 cut(s) 127
Ksp22I TGATCA 1 cut(s) 94
Kzo9I GATC 3 cut(s) 94, 212, 218
LpnPI CCDG 8 cut(s) 30, 44, 50, 95, 122, 167, 177, 201
MabI ACCWGGT 1 cut(s) 108
MalI GATC 3 cut(s) 96, 214, 220
MboI GATC 3 cut(s) 94, 212, 218
MboII GAAGA 3 cut(s) 86, 101, 220
MflI RGATCY 1 cut(s) 212
MluCI AATT 1 cut(s) 177
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 3 cut(s) 22, 70, 171
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
NdeII GATC 3 cut(s) 94, 212, 218
NlaIII CATG 1 cut(s) 127
PagI TCATGA 1 cut(s) 123
PfeI GAWTC 1 cut(s) 120
PpuMI RGGWCCY 1 cut(s) 106
Psp5II RGGWCCY 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
PspPI GGNCC 1 cut(s) 106
PspPPI RGGWCCY 1 cut(s) 106
PsuI RGATCY 1 cut(s) 212
Sau3AI GATC 3 cut(s) 94, 212, 218
Sau96I GGNCC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 110
SetI ASST 2 cut(s) 111, 158
SexAI ACCWGGT 1 cut(s) 108
SinI GGWCC 1 cut(s) 106
Sse9I AATT 1 cut(s) 177
StyD4I CCNGG 1 cut(s) 108
TasI AATT 1 cut(s) 177
TfiI GAWTC 1 cut(s) 120
TspDTI ATGAA 3 cut(s) 112, 140, 152
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.