Rh7BG054400

PHD zinc finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0013826
Physical Location & Seq
Forward (+)
3650529 .. 3650921
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG054400.1

Sequence Viewer

Length: 393 bp
ATGTCGCGATCTGTGGGTTCCAGAAGGCTATTTGAAGAGTCTGGCAGTTCAGGTCATCTAACAAGAAGAATCTCAATGCAAACCAGAGGAGAGTTTTTTTCTTTTGACAAATATGTTAAAATGTCATATAGATCTCAGAAAGTGGATTTTCCGTCACCATGTAAATGGCATGCAGGCCCTGTCCAAATAGATACCATGGTAACAATGTCTAGAAGGCATTCCAACGAGTTTAAACATGGCCGTAAAGATTTATCTTTACAAAAGGTGAAGGTTACTTACAAAAGTGAACCTACTGGACATGGCACTGAAGAAATCAATTCAATCACTGAGAAACAAGAGTCTAAATCATCCGCTGAACTAAAATGTATGAAAACTCTGGCATTGATTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

14.85

Weight (kDa)

9.8

Isoelectric Point (pI)

70.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013826)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G08005 AT5G61100 AT5G61100 AT5G61110
fragaria_vesca FvH4_5g13941
malus_domestica MD06G1202100.v1.1
prunus_persica Prupe.5G204000_v2.0.a1 Prupe.5G204100_v2.0.a1
pyrus_communis pycom06g17810
rosa_chinensis RchiOBHm_Chr7g0183011
rosa_laevigata RLG00000005090
rosa_roxburghii Rroxscaffold_3G00270880
rosa_rugosa Rorug06G0451600
rosa_samantha Rh7AG054900 Rh7BG054400 Rh7DG054500
rosa_wichuraiana Rw7G004480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 7
AciI CCGC 1 cut(s) 351
AcoI YGGCCR 1 cut(s) 238
AcuI CTGAAG 1 cut(s) 327
AgsI TTSAA 2 cut(s) 35, 321
AlwNI CAGNNNCTG 1 cut(s) 179
AoxI GGCC 2 cut(s) 175, 238
Asp700I GAANNNNTTC 1 cut(s) 217
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 2 cut(s) 147, 277
BaeI ACNNNNGTAYC 2 cut(s) 183, 216
BarI GAAGNNNNNNTAC 2 cut(s) 260, 292
BceAI ACGGC 1 cut(s) 225
BfaI CTAG 1 cut(s) 210
BglII AGATCT 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 195
Bse1I ACTGG 1 cut(s) 298
BseDI CCNNGG 1 cut(s) 195
BseGI GGATG 1 cut(s) 347
BseMII CTCAG 2 cut(s) 149, 318
BseNI ACTGG 1 cut(s) 298
BseRI GAGGAG 1 cut(s) 102
Bsh1236I CGCG 1 cut(s) 7
BshFI GGCC 2 cut(s) 177, 240
BsmI GAATGC 1 cut(s) 217
BsnI GGCC 2 cut(s) 177, 240
Bsp143I GATC 2 cut(s) 8, 131
Bsp19I CCATGG 1 cut(s) 195
Bsp68I TCGCGA 1 cut(s) 7
BspACI CCGC 1 cut(s) 351
BspANI GGCC 2 cut(s) 177, 240
BspCNI CTCAG 2 cut(s) 148, 319
BspFNI CGCG 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 19
BsrI ACTGG 1 cut(s) 298
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 2 cut(s) 8, 131
BssT1I CCWWGG 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 30
BstAPI GCANNNNNTGC 1 cut(s) 386
BstC8I GCNNGC 2 cut(s) 171, 175
BstDEI CTNAG 2 cut(s) 135, 327
BstDSI CCRYGG 1 cut(s) 195
BstF5I GGATG 1 cut(s) 347
BstFNI CGCG 1 cut(s) 7
BstKTI GATC 2 cut(s) 11, 134
BstMBI GATC 2 cut(s) 8, 131
BstMWI GCNNNNNNNGC 1 cut(s) 386
BstNSI RCATGY 1 cut(s) 173
BstUI CGCG 1 cut(s) 7
BstX2I RGATCY 1 cut(s) 131
BstXI CCANNNNNNTGG 1 cut(s) 165
BstYI RGATCY 1 cut(s) 131
BsuRI GGCC 2 cut(s) 177, 240
BtgI CCRYGG 1 cut(s) 195
BtsCI GGATG 1 cut(s) 347
BtsIMutI CAGTG 2 cut(s) 303, 324
BtuMI TCGCGA 1 cut(s) 7
Cac8I GCNNGC 2 cut(s) 171, 175
CaiI CAGNNNCTG 1 cut(s) 179
Cfr13I GGNCC 1 cut(s) 176
CviAII CATG 6 cut(s) 159, 170, 196, 236, 299, 390
CviJI RGCY 3 cut(s) 28, 177, 240
CviKI_1 RGCY 3 cut(s) 28, 177, 240
DdeI CTNAG 2 cut(s) 135, 327
DpnI GATC 2 cut(s) 10, 133
DpnII GATC 2 cut(s) 8, 131
DraI TTTAAA 1 cut(s) 232
EaeI YGGCCR 1 cut(s) 238
Eam1104I CTCTTC 1 cut(s) 30
EarI CTCTTC 1 cut(s) 30
Eco130I CCWWGG 1 cut(s) 195
Eco57I CTGAAG 1 cut(s) 327
EcoO109I RGGNCCY 1 cut(s) 176
EcoT14I CCWWGG 1 cut(s) 195
ErhI CCWWGG 1 cut(s) 195
FaeI CATG 6 cut(s) 162, 173, 199, 239, 302, 393
FatI CATG 6 cut(s) 158, 169, 195, 235, 298, 389
FokI GGATG 1 cut(s) 334
FspBI CTAG 1 cut(s) 210
HaeIII GGCC 2 cut(s) 177, 240
Hin1II CATG 6 cut(s) 162, 173, 199, 239, 302, 393
HinfI GANTC 3 cut(s) 38, 69, 338
HphI GGTGA 2 cut(s) 147, 277
Hpy166II GTNNAC 1 cut(s) 287
Hpy188I TCNGA 1 cut(s) 138
Hpy188III TCNNGA 3 cut(s) 6, 21, 210
Hpy8I GTNNAC 1 cut(s) 287
HpyAV CCTTC 3 cut(s) 18, 207, 262
HpyCH4V TGCA 3 cut(s) 79, 173, 389
HpyF10VI GCNNNNNNNGC 1 cut(s) 386
HpyF3I CTNAG 2 cut(s) 135, 327
Hsp92II CATG 6 cut(s) 162, 173, 199, 239, 302, 393
Kzo9I GATC 2 cut(s) 8, 131
LpnPI CCDG 8 cut(s) 27, 34, 36, 97, 159, 192, 279, 362
MaeI CTAG 1 cut(s) 210
MaeIII GTNAC 3 cut(s) 153, 199, 271
MalI GATC 2 cut(s) 10, 133
MboI GATC 2 cut(s) 8, 131
MboII GAAGA 3 cut(s) 47, 78, 320
MflI RGATCY 1 cut(s) 131
MluCI AATT 1 cut(s) 316
MlyI GAGTC 2 cut(s) 47, 347
MmeI TCCRAC 1 cut(s) 246
MnlI CCTC 1 cut(s) 80
MroXI GAANNNNTTC 1 cut(s) 217
MseI TTAA 2 cut(s) 117, 231
MslI CAYNNNNRTG 1 cut(s) 163
MspA1I CMGCKG 1 cut(s) 353
MssI GTTTAAAC 1 cut(s) 232
Mva1269I GAATGC 1 cut(s) 217
MvnI CGCG 1 cut(s) 7
MwoI GCNNNNNNNGC 1 cut(s) 386
NcoI CCATGG 1 cut(s) 195
NdeII GATC 2 cut(s) 8, 131
NlaIII CATG 6 cut(s) 162, 173, 199, 239, 302, 393
NlaIV GGNNCC 1 cut(s) 19
NmuCI GTSAC 1 cut(s) 153
NruI TCGCGA 1 cut(s) 7
NspI RCATGY 1 cut(s) 173
PaeI GCATGC 1 cut(s) 173
PctI GAATGC 1 cut(s) 217
PdmI GAANNNNTTC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 69
PleI GAGTC 2 cut(s) 46, 346
PmeI GTTTAAAC 1 cut(s) 232
PpsI GAGTC 2 cut(s) 46, 346
PspN4I GGNNCC 1 cut(s) 19
PspPI GGNCC 1 cut(s) 176
PstNI CAGNNNCTG 1 cut(s) 179
PsuI RGATCY 1 cut(s) 131
RruI TCGCGA 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 163
SaqAI TTAA 2 cut(s) 117, 231
Sau3AI GATC 2 cut(s) 8, 131
Sau96I GGNCC 1 cut(s) 176
SchI GAGTC 2 cut(s) 47, 347
SetI ASST 4 cut(s) 55, 267, 273, 292
SmiMI CAYNNNNRTG 1 cut(s) 163
SphI GCATGC 1 cut(s) 173
Sse9I AATT 1 cut(s) 316
SsiI CCGC 1 cut(s) 351
SspMI CTAG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 195
TasI AATT 1 cut(s) 316
TfiI GAWTC 1 cut(s) 69
Tru1I TTAA 2 cut(s) 117, 231
Tru9I TTAA 2 cut(s) 117, 231
TscAI CASTG 2 cut(s) 310, 331
TseFI GTSAC 1 cut(s) 153
Tsp45I GTSAC 1 cut(s) 153
TspDTI ATGAA 1 cut(s) 383
TspGWI ACGGA 1 cut(s) 141
TspRI CASTG 2 cut(s) 310, 331
XbaI TCTAGA 1 cut(s) 209
XceI RCATGY 1 cut(s) 173
XmnI GAANNNNTTC 1 cut(s) 217
XspI CTAG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.