Rh7DG467400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
66678271 .. 66678453
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG467400.1

Sequence Viewer

Length: 183 bp
ATGGGTTCTTCTTTGGCGATAATCCCAGAAGATGTATTGGAGTCTCTAATGAACGACGACACCATTGACGCTCTCAGATTAAAGATCAGCAATCAGCTCAAAGCTAATGAAGAGCTGAAGAGCACAACAATCAAAATGGCAGAGAAAAGCCGAGTTCTCAACACTCATGGGGCAGAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.61

Weight (kDa)

5.21

Isoelectric Point (pI)

25.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011316)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 137
AluBI AGCT 3 cut(s) 97, 104, 115
AluI AGCT 3 cut(s) 97, 104, 115
Alw21I GWGCWC 1 cut(s) 125
Alw26I GTCTC 1 cut(s) 48
Bbv12I GWGCWC 1 cut(s) 125
BcoDI GTCTC 1 cut(s) 48
BseMII CTCAG 1 cut(s) 88
BsiHKAI GWGCWC 1 cut(s) 125
BsmAI GTCTC 1 cut(s) 48
Bsp1286I GDGCHC 1 cut(s) 125
Bsp143I GATC 1 cut(s) 84
BspCNI CTCAG 1 cut(s) 87
BspQI GCTCTTC 2 cut(s) 105, 113
BssMI GATC 1 cut(s) 84
Bst6I CTCTTC 2 cut(s) 105, 113
BstDEI CTNAG 1 cut(s) 74
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 1 cut(s) 48
BstMBI GATC 1 cut(s) 84
CseI GACGC 1 cut(s) 77
CviAII CATG 1 cut(s) 167
CviJI RGCY 4 cut(s) 97, 104, 115, 150
CviKI_1 RGCY 4 cut(s) 97, 104, 115, 150
DdeI CTNAG 1 cut(s) 74
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Eam1104I CTCTTC 2 cut(s) 105, 113
EarI CTCTTC 2 cut(s) 105, 113
Eco57I CTGAAG 1 cut(s) 137
FaeI CATG 1 cut(s) 170
FaiI YATR 1 cut(s) 168
FatI CATG 1 cut(s) 166
FspEI CC 9 cut(s) 23, 38, 39, 76, 122, 153, 154, 155, 164
HgaI GACGC 1 cut(s) 77
Hin1II CATG 1 cut(s) 170
HinfI GANTC 1 cut(s) 41
Hpy188I TCNGA 1 cut(s) 77
Hpy99I CGWCG 1 cut(s) 59
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 1 cut(s) 170
Kzo9I GATC 1 cut(s) 84
LguI GCTCTTC 2 cut(s) 105, 113
LpnPI CCDG 1 cut(s) 39
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 3 cut(s) 41, 122, 130
MhlI GDGCHC 1 cut(s) 125
MlyI GAGTC 1 cut(s) 50
MseI TTAA 1 cut(s) 80
NdeII GATC 1 cut(s) 84
NlaIII CATG 1 cut(s) 170
NmeAIII GCCGAG 1 cut(s) 176
PciSI GCTCTTC 2 cut(s) 105, 113
PleI GAGTC 1 cut(s) 49
PpsI GAGTC 1 cut(s) 49
SapI GCTCTTC 2 cut(s) 105, 113
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 1 cut(s) 84
SchI GAGTC 1 cut(s) 50
SduI GDGCHC 1 cut(s) 125
SetI ASST 3 cut(s) 99, 106, 117
SgeI CNNG 3 cut(s) 38, 164, 179
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TspDTI ATGAA 2 cut(s) 65, 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.