Rw5G013920

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
16422866 .. 16423243
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G013920.1

Sequence Viewer

Length: 225 bp
ATGGCGAAGTCGATGAGATGCAAGAGAGAGAAGAGGCTTCGGGCTATTCGCAGAGAGATGGTAGAGCCCTACTACGAGAAGAAAGACGAGGCCAAGCTCGCTGCCCAAGAGGCTGCCCTCGCCGCCCCTAAGCTGCCCGTAAAGCCCTCTTCTATGGAGATCGCCCCCGTCAACACCTCAACGCCTTCTGAAAACGCCATGGGAAATAGGTGCATGGTTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.32

Weight (kDa)

9.51

Isoelectric Point (pI)

57.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010200)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 123
AluBI AGCT 2 cut(s) 97, 133
AluI AGCT 2 cut(s) 97, 133
AoxI GGCC 1 cut(s) 90
ApeKI GCWGC 3 cut(s) 101, 113, 133
BanII GRGCYC 1 cut(s) 69
BbvI GCAGC 3 cut(s) 88, 100, 120
BccI CCATC 1 cut(s) 52
BglI GCCNNNNNGGC 1 cut(s) 110
BisI GCNGC 4 cut(s) 102, 114, 123, 134
BlsI GCNGC 4 cut(s) 103, 115, 124, 135
BmsI GCATC 1 cut(s) 8
Bpu10I CCTNAGC 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 198
BseDI CCNNGG 1 cut(s) 198
BseXI GCAGC 3 cut(s) 88, 100, 120
BshFI GGCC 1 cut(s) 92
BsnI GGCC 1 cut(s) 92
Bsp1286I GDGCHC 1 cut(s) 69
Bsp143I GATC 1 cut(s) 159
Bsp19I CCATGG 1 cut(s) 198
BspACI CCGC 1 cut(s) 123
BspANI GGCC 1 cut(s) 92
BssECI CCNNGG 1 cut(s) 198
BssMI GATC 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 198
Bst6I CTCTTC 2 cut(s) 26, 154
BstC8I GCNNGC 1 cut(s) 99
BstDEI CTNAG 1 cut(s) 129
BstDSI CCRYGG 1 cut(s) 198
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BstMWI GCNNNNNNNGC 5 cut(s) 98, 110, 119, 122, 142
BstV1I GCAGC 3 cut(s) 88, 100, 120
BsuRI GGCC 1 cut(s) 92
BtgI CCRYGG 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 99
CviAII CATG 2 cut(s) 199, 214
CviJI RGCY 8 cut(s) 37, 44, 67, 92, 97, 113, 133, 145
CviKI_1 RGCY 8 cut(s) 37, 44, 67, 92, 97, 113, 133, 145
DdeI CTNAG 1 cut(s) 129
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
Eam1104I CTCTTC 2 cut(s) 26, 154
EarI CTCTTC 2 cut(s) 26, 154
Eco130I CCWWGG 1 cut(s) 198
Eco24I GRGCYC 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 198
EcoT38I GRGCYC 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 198
FaeI CATG 2 cut(s) 202, 217
FaiI YATR 3 cut(s) 155, 200, 215
FatI CATG 2 cut(s) 198, 213
Fnu4HI GCNGC 4 cut(s) 102, 114, 123, 134
FriOI GRGCYC 1 cut(s) 69
Fsp4HI GCNGC 4 cut(s) 102, 114, 123, 134
GluI GCNGC 4 cut(s) 102, 114, 123, 134
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 2 cut(s) 202, 217
HincII GTYRAC 2 cut(s) 172, 220
HindII GTYRAC 2 cut(s) 172, 220
Hpy166II GTNNAC 2 cut(s) 172, 220
Hpy188I TCNGA 1 cut(s) 190
Hpy8I GTNNAC 2 cut(s) 172, 220
HpyAV CCTTC 1 cut(s) 195
HpyCH4V TGCA 2 cut(s) 21, 213
HpyF10VI GCNNNNNNNGC 5 cut(s) 98, 110, 119, 122, 142
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 2 cut(s) 202, 217
Kzo9I GATC 1 cut(s) 159
Lsp1109I GCAGC 3 cut(s) 88, 100, 120
LweI GCATC 1 cut(s) 8
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 3 cut(s) 43, 91, 141
MhlI GDGCHC 1 cut(s) 69
MnlI CCTC 6 cut(s) 27, 82, 103, 128, 157, 187
MwoI GCNNNNNNNGC 5 cut(s) 98, 110, 119, 122, 142
NcoI CCATGG 1 cut(s) 198
NdeII GATC 1 cut(s) 159
NlaIII CATG 2 cut(s) 202, 217
PkrI GCNGC 4 cut(s) 103, 115, 124, 135
SatI GCNGC 4 cut(s) 102, 114, 123, 134
Sau3AI GATC 1 cut(s) 159
SduI GDGCHC 1 cut(s) 69
SetI ASST 4 cut(s) 99, 135, 179, 212
SfaNI GCATC 1 cut(s) 8
SsiI CCGC 1 cut(s) 123
StyI CCWWGG 1 cut(s) 198
TaqI TCGA 1 cut(s) 11
TauI GCSGC 1 cut(s) 125
TseI GCWGC 3 cut(s) 101, 113, 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.