Rw6G026170

50S ribosomal protein L10

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0016095
Physical Location & Seq
Reverse (-)
49567068 .. 49568112
1045 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G026170.1

Sequence Viewer

Length: 660 bp
ATGTCCATGATTTGGGACAACCTAATTGATTCATTTGGCTGTCTCTCATACCCATTCCTCTCCCTCCCCTCCCATCCCCACCGCCGCCGCCTCCGCCTCCCCACCATCCGCTCCGCCATTTCCCGCACCAAGAAAGAAGAGACCGTCGAAACCATCAAGACCAATCTCGACAACTGCTACCTCCTGGCCGGCATCGGCTACAAAGGCCTCACCGTCAAGCAATTACAGGACCTCCGCAAAGCCCTACCGGACTCCACCAAGCTCATCGTCGCCAAGAACACTCTCGTCTACAAAGCCATCGAGGGAACCCCCTGGGAGGCTCTCAAGCCTTGCATGACCGGAATGAACGCCTGGCTGTTCGTCCACAGCGAGGAGATCCCGCCGGCGATTAAGCCCTACCGGGATTTCCAGAAGGAACGCAAGCTCGAGAACAACGACTTCACCGGAGCGGTGTTCGAGGGCAAGTTCTACGGCCCCGGAGACTTCAAGGCGCTGGAGACAATGCCGACGAGGCTGGAGATTTATGCCAAGTTGCTTGGCTCCCTCAAGGGGCCGGCGTCCAACCTCGTCGGGACGATTCAGGCGCCGGCGAGGGAGCTGGTCATGACTTTGCAGGCCTATGTGCAGAAATTGGAGGAGAGCGGCGGCGCCGGGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L10

Protein Analysis

219

Amino Acids

24.54

Weight (kDa)

9.15

Isoelectric Point (pI)

41.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L10 PF00466 42 - 136 1.9e-19 Ribosomal protein L10
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016095)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G13510
fragaria_vesca FvH4_2g21340
malus_domestica MD05G1196100.v1.1 MD10G1183400.v1.1
prunus_persica Prupe.8G222500_v2.0.a1
pyrus_communis pycom05g18310 pycom10g15840
rosa_chinensis RchiOBHm_Chr6g0287931
rosa_laevigata RLG00000012455
rosa_multiflora Rmu_sc0000042.1_g000003
rosa_roxburghii Rroxscaffold_7G00180660
rosa_rugosa Rorug06G0193500
rosa_samantha Rh6CG300800 Rh6DG301400
rosa_wichuraiana Rw6G026170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 583, 647
AccB7I CCANNNNNTGG 1 cut(s) 12
AccBSI CCGCTC 3 cut(s) 111, 449, 642
AccI GTMKAC 1 cut(s) 288
AclWI GGATC 1 cut(s) 370
AcoI YGGCCR 1 cut(s) 186
AcyI GRCGYC 3 cut(s) 557, 584, 648
AfiI CCNNNNNNNGG 4 cut(s) 12, 316, 370, 549
AgsI TTSAA 1 cut(s) 487
AjnI CCWGG 3 cut(s) 183, 311, 350
AluBI AGCT 3 cut(s) 262, 424, 598
AluI AGCT 3 cut(s) 262, 424, 598
Alw26I GTCTC 4 cut(s) 47, 134, 474, 491
AlwI GGATC 1 cut(s) 370
Ama87I CYCGRG 1 cut(s) 425
AoxI GGCC 5 cut(s) 186, 205, 472, 551, 615
AspLEI GCGC 3 cut(s) 493, 586, 650
AspS9I GGNCC 3 cut(s) 229, 473, 551
AsuC2I CCSGG 3 cut(s) 401, 477, 652
AsuHPI GGTGA 2 cut(s) 202, 433
AvaI CYCGRG 1 cut(s) 425
AvaII GGWCC 1 cut(s) 229
BanI GGYRCC 2 cut(s) 583, 647
BccI CCATC 4 cut(s) 81, 113, 161, 305
BceAI ACGGC 1 cut(s) 487
BciT130I CCWGG 3 cut(s) 185, 313, 352
BcnI CCSGG 3 cut(s) 401, 477, 652
BcoDI GTCTC 4 cut(s) 47, 134, 474, 491
BfoI RGCGCY 3 cut(s) 494, 587, 651
BglI GCCNNNNNGGC 1 cut(s) 511
BisI GCNGC 4 cut(s) 85, 88, 643, 646
BlsI GCNGC 4 cut(s) 86, 89, 644, 647
Bme1390I CCNGG 6 cut(s) 185, 313, 352, 401, 477, 652
Bme18I GGWCC 1 cut(s) 229
BmeT110I CYCGRG 1 cut(s) 425
BmgT120I GGNCC 3 cut(s) 229, 473, 551
BmiI GGNNCC 6 cut(s) 307, 475, 541, 552, 585, 649
BmrFI CCNGG 6 cut(s) 185, 313, 352, 401, 477, 652
BmsI GCATC 1 cut(s) 201
BpmI CTGGAG 2 cut(s) 515, 536
BpuEI CTTGAG 2 cut(s) 308, 530
BpuMI CCSGG 3 cut(s) 401, 477, 652
BsaHI GRCGYC 3 cut(s) 557, 584, 648
BsaI GGTCTC 1 cut(s) 134
BsaJI CCNNGG 3 cut(s) 311, 312, 475
BsaWI WCCGGW 3 cut(s) 247, 338, 443
BsaXI ACNNNNNCTCC 2 cut(s) 216, 246
Bsc4I CCNNNNNNNGG 4 cut(s) 12, 316, 370, 549
Bse118I RCCGGY 4 cut(s) 188, 382, 553, 586
BseBI CCWGG 3 cut(s) 185, 313, 352
BseDI CCNNGG 3 cut(s) 311, 312, 475
BseGI GGATG 2 cut(s) 73, 105
BseLI CCNNNNNNNGG 4 cut(s) 12, 316, 370, 549
BseRI GAGGAG 2 cut(s) 386, 650
BsgI GTGCAG 1 cut(s) 644
BshFI GGCC 5 cut(s) 188, 207, 474, 553, 617
BshNI GGYRCC 2 cut(s) 583, 647
BsiHKCI CYCGRG 1 cut(s) 425
BslFI GGGAC 2 cut(s) 29, 586
BslI CCNNNNNNNGG 4 cut(s) 12, 316, 370, 549
BsmAI GTCTC 4 cut(s) 47, 134, 474, 491
BsmFI GGGAC 2 cut(s) 29, 586
BsnI GGCC 5 cut(s) 188, 207, 474, 553, 617
Bso31I GGTCTC 1 cut(s) 134
BsoBI CYCGRG 1 cut(s) 425
Bsp143I GATC 1 cut(s) 375
BspANI GGCC 5 cut(s) 188, 207, 474, 553, 617
BspHI TCATGA 1 cut(s) 603
BspLI GGNNCC 6 cut(s) 307, 475, 541, 552, 585, 649
BspPI GGATC 1 cut(s) 370
BspT107I GGYRCC 2 cut(s) 583, 647
BspTNI GGTCTC 1 cut(s) 134
BsrBI CCGCTC 3 cut(s) 111, 449, 642
BsrFI RCCGGY 4 cut(s) 188, 382, 553, 586
BssAI RCCGGY 4 cut(s) 188, 382, 553, 586
BssECI CCNNGG 3 cut(s) 311, 312, 475
BssMI GATC 1 cut(s) 375
BssNI GRCGYC 3 cut(s) 557, 584, 648
Bst2UI CCWGG 3 cut(s) 185, 313, 352
Bst4CI ACNGT 2 cut(s) 145, 214
Bst6I CTCTTC 1 cut(s) 132
BstACI GRCGYC 3 cut(s) 557, 584, 648
BstC8I GCNNGC 6 cut(s) 190, 384, 422, 555, 588, 615
BstF5I GGATG 2 cut(s) 73, 105
BstH2I RGCGCY 3 cut(s) 494, 587, 651
BstHHI GCGC 3 cut(s) 493, 586, 650
BstKTI GATC 1 cut(s) 378
BstMAI GTCTC 4 cut(s) 47, 134, 474, 491
BstMBI GATC 1 cut(s) 375
BstMWI GCNNNNNNNGC 3 cut(s) 93, 204, 511
BstNI CCWGG 3 cut(s) 185, 313, 352
BstSCI CCNGG 6 cut(s) 183, 311, 350, 399, 475, 650
BstX2I RGATCY 1 cut(s) 375
BstYI RGATCY 1 cut(s) 375
BsuRI GGCC 5 cut(s) 188, 207, 474, 553, 617
BtsCI GGATG 2 cut(s) 73, 105
Cac8I GCNNGC 6 cut(s) 190, 384, 422, 555, 588, 615
CciI TCATGA 1 cut(s) 603
CfoI GCGC 3 cut(s) 493, 586, 650
Cfr10I RCCGGY 4 cut(s) 188, 382, 553, 586
Cfr13I GGNCC 3 cut(s) 229, 473, 551
CseI GACGC 1 cut(s) 546
CviAII CATG 3 cut(s) 7, 334, 604
DinI GGCGCC 2 cut(s) 585, 649
DpnI GATC 1 cut(s) 377
DpnII GATC 1 cut(s) 375
EaeI YGGCCR 1 cut(s) 186
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
EciI GGCGGA 2 cut(s) 83, 103
Eco147I AGGCCT 2 cut(s) 207, 617
Eco31I GGTCTC 1 cut(s) 134
Eco47I GGWCC 1 cut(s) 229
Eco88I CYCGRG 1 cut(s) 425
EcoO109I RGGNCCY 1 cut(s) 229
EcoRII CCWGG 3 cut(s) 183, 311, 350
EgeI GGCGCC 2 cut(s) 585, 649
EheI GGCGCC 2 cut(s) 585, 649
FaeI CATG 3 cut(s) 10, 337, 607
FaiI YATR 6 cut(s) 8, 49, 335, 525, 605, 621
FaqI GGGAC 2 cut(s) 29, 586
FatI CATG 3 cut(s) 6, 333, 603
FauI CCCGC 2 cut(s) 131, 387
FblI GTMKAC 1 cut(s) 288
Fnu4HI GCNGC 4 cut(s) 85, 88, 643, 646
FokI GGATG 2 cut(s) 60, 92
Fsp4HI GCNGC 4 cut(s) 85, 88, 643, 646
GlaI GCGC 3 cut(s) 492, 585, 649
GluI GCNGC 4 cut(s) 85, 88, 643, 646
GsuI CTGGAG 2 cut(s) 515, 536
HaeII RGCGCY 3 cut(s) 494, 587, 651
HaeIII GGCC 5 cut(s) 188, 207, 474, 553, 617
HgaI GACGC 1 cut(s) 546
HhaI GCGC 3 cut(s) 493, 586, 650
Hin1I GRCGYC 3 cut(s) 557, 584, 648
Hin1II CATG 3 cut(s) 10, 337, 607
Hin6I GCGC 3 cut(s) 491, 584, 648
HinP1I GCGC 3 cut(s) 491, 584, 648
HinfI GANTC 3 cut(s) 29, 251, 577
HphI GGTGA 2 cut(s) 202, 433
Hpy166II GTNNAC 2 cut(s) 289, 364
Hpy188III TCNNGA 6 cut(s) 157, 167, 409, 427, 571, 604
Hpy8I GTNNAC 2 cut(s) 289, 364
Hpy99I CGWCG 4 cut(s) 149, 272, 511, 572
HpyAV CCTTC 1 cut(s) 406
HpyCH4III ACNGT 2 cut(s) 145, 214
HpyCH4V TGCA 3 cut(s) 333, 613, 625
HpyF10VI GCNNNNNNNGC 3 cut(s) 93, 204, 511
Hsp92I GRCGYC 3 cut(s) 557, 584, 648
Hsp92II CATG 3 cut(s) 10, 337, 607
HspAI GCGC 3 cut(s) 491, 584, 648
KasI GGCGCC 2 cut(s) 583, 647
KroI GCCGGC 4 cut(s) 188, 382, 553, 586
KroNI GCCGGC 4 cut(s) 190, 384, 555, 588
Kzo9I GATC 1 cut(s) 375
LmnI GCTCC 4 cut(s) 116, 446, 545, 595
LweI GCATC 1 cut(s) 201
MalI GATC 1 cut(s) 377
MbiI CCGCTC 3 cut(s) 111, 449, 642
MboI GATC 1 cut(s) 375
MboII GAAGA 1 cut(s) 149
MflI RGATCY 1 cut(s) 375
MluCI AATT 3 cut(s) 24, 221, 629
Mly113I GGCGCC 2 cut(s) 584, 648
MlyI GAGTC 1 cut(s) 245
MmeI TCCRAC 1 cut(s) 585
MreI CGCCGGCG 2 cut(s) 382, 586
MroNI GCCGGC 4 cut(s) 188, 382, 553, 586
MseI TTAA 1 cut(s) 390
MspR9I CCNGG 6 cut(s) 185, 313, 352, 401, 477, 652
MvaI CCWGG 3 cut(s) 185, 313, 352
MwoI GCNNNNNNNGC 3 cut(s) 93, 204, 511
NaeI GCCGGC 4 cut(s) 190, 384, 555, 588
NarI GGCGCC 2 cut(s) 584, 648
NciI CCSGG 3 cut(s) 401, 477, 652
NdeII GATC 1 cut(s) 375
NgoMIV GCCGGC 4 cut(s) 188, 382, 553, 586
NlaIII CATG 3 cut(s) 10, 337, 607
NlaIV GGNNCC 6 cut(s) 307, 475, 541, 552, 585, 649
PaeR7I CTCGAG 1 cut(s) 425
PagI TCATGA 1 cut(s) 603
PasI CCCWGGG 1 cut(s) 312
PceI AGGCCT 2 cut(s) 207, 617
PcsI WCGNNNNNNNCGW 2 cut(s) 366, 432
PdiI GCCGGC 4 cut(s) 190, 384, 555, 588
PfeI GAWTC 2 cut(s) 29, 577
PflMI CCANNNNNTGG 1 cut(s) 12
PkrI GCNGC 4 cut(s) 86, 89, 644, 647
PleI GAGTC 1 cut(s) 245
PluTI GGCGCC 2 cut(s) 587, 651
PpsI GAGTC 1 cut(s) 245
PpuMI RGGWCCY 1 cut(s) 229
Psp5II RGGWCCY 1 cut(s) 229
Psp6I CCWGG 3 cut(s) 183, 311, 350
PspGI CCWGG 3 cut(s) 183, 311, 350
PspN4I GGNNCC 6 cut(s) 307, 475, 541, 552, 585, 649
PspPI GGNCC 3 cut(s) 229, 473, 551
PspPPI RGGWCCY 1 cut(s) 229
PsuI RGATCY 1 cut(s) 375
SaqAI TTAA 1 cut(s) 390
SatI GCNGC 4 cut(s) 85, 88, 643, 646
Sau3AI GATC 1 cut(s) 375
Sau96I GGNCC 3 cut(s) 229, 473, 551
SchI GAGTC 1 cut(s) 245
ScrFI CCNGG 6 cut(s) 185, 313, 352, 401, 477, 652
SetI ASST 7 cut(s) 24, 183, 234, 264, 426, 567, 600
SfaNI GCATC 1 cut(s) 201
SfoI GGCGCC 2 cut(s) 585, 649
Sfr274I CTCGAG 1 cut(s) 425
SgrAI CRCCGGYG 2 cut(s) 382, 586
SinI GGWCC 1 cut(s) 229
SlaI CTCGAG 1 cut(s) 425
SmlI CTYRAG 3 cut(s) 323, 425, 545
SmoI CTYRAG 3 cut(s) 323, 425, 545
Sse9I AATT 3 cut(s) 24, 221, 629
SseBI AGGCCT 2 cut(s) 207, 617
SspDI GGCGCC 2 cut(s) 583, 647
StuI AGGCCT 2 cut(s) 207, 617
StyD4I CCNGG 6 cut(s) 183, 311, 350, 399, 475, 650
TaaI ACNGT 2 cut(s) 145, 214
TaqI TCGA 5 cut(s) 147, 168, 300, 426, 456
TasI AATT 3 cut(s) 24, 221, 629
TauI GCSGC 4 cut(s) 87, 90, 645, 648
TfiI GAWTC 2 cut(s) 29, 577
Tru1I TTAA 1 cut(s) 390
Tru9I TTAA 1 cut(s) 390
TspDTI ATGAA 2 cut(s) 21, 359
Van91I CCANNNNNTGG 1 cut(s) 12
VpaK11BI GGWCC 1 cut(s) 229
XhoI CTCGAG 1 cut(s) 425
XmiI GTMKAC 1 cut(s) 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.