Rw6G035080

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
59620797 .. 59621042
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G035080.1

Sequence Viewer

Length: 213 bp
ATGGCCACCTGGCCCTCCTCATCCGATCCTTCTAATCATGAGGCTGTTGCAATAAGGAAGAGAAACAAGTCTGATCAAATTAAGTTCTTGATTCCTCTCATCTACACCTCTAATCCGGTTGTGCAGGACTGTTTGTTTACTACTGTGTTGGTTGGAGCATTTGCTTATGGCTCTTATTTGGTGACGGATCTTTATGATATCGAGAGCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.83

Weight (kDa)

5.55

Isoelectric Point (pI)

42.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012355)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 20, 195
AcoI YGGCCR 1 cut(s) 3
AjnI CCWGG 1 cut(s) 8
AlwI GGATC 2 cut(s) 20, 195
AoxI GGCC 2 cut(s) 3, 11
AspS9I GGNCC 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 193
BalI TGGCCA 1 cut(s) 5
BciT130I CCWGG 1 cut(s) 10
BclI TGATCA 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 10
BmgT120I GGNCC 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 10
BsaWI WCCGGW 1 cut(s) 115
BseBI CCWGG 1 cut(s) 10
BseGI GGATG 1 cut(s) 20
BseRI GAGGAG 1 cut(s) 7
BsgI GTGCAG 1 cut(s) 143
BshFI GGCC 2 cut(s) 5, 13
BsiSI CCGG 1 cut(s) 116
BsnI GGCC 2 cut(s) 5, 13
Bsp143I GATC 3 cut(s) 25, 73, 187
BspANI GGCC 2 cut(s) 5, 13
BspHI TCATGA 1 cut(s) 37
BspPI GGATC 2 cut(s) 20, 195
BssMI GATC 3 cut(s) 25, 73, 187
Bst2UI CCWGG 1 cut(s) 10
Bst4CI ACNGT 2 cut(s) 131, 145
Bst6I CTCTTC 1 cut(s) 53
BstF5I GGATG 1 cut(s) 20
BstKTI GATC 3 cut(s) 28, 76, 190
BstMBI GATC 3 cut(s) 25, 73, 187
BstNI CCWGG 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 8
BstX2I RGATCY 1 cut(s) 187
BstYI RGATCY 1 cut(s) 187
BsuRI GGCC 2 cut(s) 5, 13
BtsCI GGATG 1 cut(s) 20
CciI TCATGA 1 cut(s) 37
Cfr13I GGNCC 1 cut(s) 12
CviAII CATG 1 cut(s) 38
CviJI RGCY 4 cut(s) 5, 13, 44, 171
CviKI_1 RGCY 4 cut(s) 5, 13, 44, 171
DpnI GATC 3 cut(s) 27, 75, 189
DpnII GATC 3 cut(s) 25, 73, 187
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 53
EarI CTCTTC 1 cut(s) 53
Eco32I GATATC 1 cut(s) 199
EcoRII CCWGG 1 cut(s) 8
EcoRV GATATC 1 cut(s) 199
FaeI CATG 1 cut(s) 41
FaiI YATR 3 cut(s) 39, 168, 195
FatI CATG 1 cut(s) 37
FbaI TGATCA 1 cut(s) 73
FokI GGATG 1 cut(s) 7
HaeIII GGCC 2 cut(s) 5, 13
HapII CCGG 1 cut(s) 116
Hin1II CATG 1 cut(s) 41
HinfI GANTC 1 cut(s) 91
HpaII CCGG 1 cut(s) 116
HphI GGTGA 1 cut(s) 193
Hpy166II GTNNAC 1 cut(s) 138
Hpy188I TCNGA 2 cut(s) 25, 73
Hpy188III TCNNGA 3 cut(s) 38, 88, 202
Hpy8I GTNNAC 1 cut(s) 138
HpyAV CCTTC 1 cut(s) 39
HpyCH4III ACNGT 2 cut(s) 131, 145
HpyCH4V TGCA 2 cut(s) 50, 124
Hsp92II CATG 1 cut(s) 41
Ksp22I TGATCA 1 cut(s) 73
Kzo9I GATC 3 cut(s) 25, 73, 187
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 3 cut(s) 22, 110, 129
MaeIII GTNAC 1 cut(s) 181
MalI GATC 3 cut(s) 27, 75, 189
MboI GATC 3 cut(s) 25, 73, 187
MboII GAAGA 1 cut(s) 70
MflI RGATCY 1 cut(s) 187
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 78
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 133
MnlI CCTC 5 cut(s) 25, 28, 34, 105, 118
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 81
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 1 cut(s) 116
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
NdeII GATC 3 cut(s) 25, 73, 187
NlaIII CATG 1 cut(s) 41
NmuCI GTSAC 1 cut(s) 181
PagI TCATGA 1 cut(s) 37
PfeI GAWTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
PspPI GGNCC 1 cut(s) 12
PsuI RGATCY 1 cut(s) 187
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 3 cut(s) 25, 73, 187
Sau96I GGNCC 1 cut(s) 12
ScrFI CCNGG 1 cut(s) 10
SetI ASST 2 cut(s) 11, 110
SgeI CNNG 7 cut(s) 21, 22, 50, 79, 100, 128, 137
Sse9I AATT 1 cut(s) 78
StyD4I CCNGG 1 cut(s) 8
TaaI ACNGT 2 cut(s) 131, 145
TaqI TCGA 1 cut(s) 201
TasI AATT 1 cut(s) 78
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TseFI GTSAC 1 cut(s) 181
Tsp45I GTSAC 1 cut(s) 181
TspGWI ACGGA 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.