AT1G21550

calcium-binding protein CML44

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Reverse (-)
7552987 .. 7553975
989 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G21550.1

Sequence Viewer

Length: 468 bp
ATGGATTGTTCATTCATAACTACAAACGATCTCCGAAGAATGTTCAAGACGCTCGACAAGAACCAAGACGGGCTTGTGACCCTCGACGAGCTCCTTTGGATTCTTGATAAACTCGGTTGGGCCGAACACACTCCCGATGAGCTTGAACTGATCGTTGGTAAACAGAGCCTCGATTTAGACGAGTTCCTTCGGTTCTACTACGACGCTGTTTTAGATAGCAAAGGATCTAAGAAGAATATTGATGTTGTTGCTGATAATGATGAAGCGATTGCGAGGGCGTTTAATGTGTTCGATGTGAACGGAGATGGTTATATTTCAGCGGAGGAGCTTCGTGATGTGTTGGAACGGCTAGGGTTTGAGGAGGAGGCAAAGGCTTGGGATTGTGGGAGAATGATTCGAGTTCATGACAAGAATCTTGATGGTTTTGTTGACTTTGAAGAATTCAAGAACATGATCTTACATGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

155

Amino Acids

17.94

Weight (kDa)

4.4

Isoelectric Point (pI)

31.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_1 PF00036 10 - 37 5.7e-06 EF hand domain
EF-hand_7 PF13499 88 - 152 6.3e-12 EF-hand domain pair
EF-hand_6 PF13405 90 - 118 9.6e-09 EF-hand domain
EF-hand_1 PF00036 91 - 116 6e-08 EF hand domain
EF-hand_5 PF13202 92 - 113 2.5e-08 EF hand
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 320
AclWI GGATC 1 cut(s) 232
AcsI RAATTY 1 cut(s) 440
AflIII ACRYGT 1 cut(s) 460
AgsI TTSAA 4 cut(s) 46, 146, 437, 445
AjuI GAANNNNNNNTTGG 2 cut(s) 138, 170
AluBI AGCT 3 cut(s) 91, 142, 328
AluI AGCT 3 cut(s) 91, 142, 328
Alw21I GWGCWC 1 cut(s) 93
AlwI GGATC 1 cut(s) 232
AoxI GGCC 1 cut(s) 120
ApoI RAATTY 1 cut(s) 440
AspS9I GGNCC 1 cut(s) 120
BanII GRGCYC 1 cut(s) 93
Bbv12I GWGCWC 1 cut(s) 93
BccI CCATC 2 cut(s) 299, 413
BceAI ACGGC 1 cut(s) 362
BfaI CTAG 1 cut(s) 350
BmgT120I GGNCC 1 cut(s) 120
BseRI GAGGAG 3 cut(s) 338, 374, 377
BshFI GGCC 1 cut(s) 122
BsiHKAI GWGCWC 1 cut(s) 93
BsnI GGCC 1 cut(s) 122
Bsp1286I GDGCHC 1 cut(s) 93
Bsp143I GATC 4 cut(s) 28, 150, 224, 453
BspACI CCGC 1 cut(s) 320
BspANI GGCC 1 cut(s) 122
BspHI TCATGA 1 cut(s) 403
BspPI GGATC 1 cut(s) 232
BssMI GATC 4 cut(s) 28, 150, 224, 453
BstDEI CTNAG 1 cut(s) 228
BstKTI GATC 4 cut(s) 31, 153, 227, 456
BstMBI GATC 4 cut(s) 28, 150, 224, 453
BstNSI RCATGY 1 cut(s) 464
BstX2I RGATCY 1 cut(s) 224
BstYI RGATCY 1 cut(s) 224
BsuRI GGCC 1 cut(s) 122
CciI TCATGA 1 cut(s) 403
Cfr13I GGNCC 1 cut(s) 120
CseI GACGC 2 cut(s) 58, 212
CviAII CATG 3 cut(s) 404, 451, 461
CviJI RGCY 8 cut(s) 73, 91, 122, 142, 168, 328, 349, 374
CviKI_1 RGCY 8 cut(s) 73, 91, 122, 142, 168, 328, 349, 374
DdeI CTNAG 1 cut(s) 228
DpnI GATC 4 cut(s) 30, 152, 226, 455
DpnII GATC 4 cut(s) 28, 150, 224, 453
Ecl136II GAGCTC 1 cut(s) 91
Eco24I GRGCYC 1 cut(s) 93
Eco53kI GAGCTC 1 cut(s) 91
EcoICRI GAGCTC 1 cut(s) 91
EcoRI GAATTC 1 cut(s) 440
EcoT38I GRGCYC 1 cut(s) 93
FaeI CATG 3 cut(s) 407, 454, 464
FaiI YATR 5 cut(s) 17, 312, 405, 452, 462
FalI AAGNNNNNCTT 2 cut(s) 57, 89
FatI CATG 3 cut(s) 403, 450, 460
FriOI GRGCYC 1 cut(s) 93
FspBI CTAG 1 cut(s) 350
HaeIII GGCC 1 cut(s) 122
HgaI GACGC 2 cut(s) 58, 212
Hin1II CATG 3 cut(s) 407, 454, 464
HincII GTYRAC 1 cut(s) 430
HindII GTYRAC 1 cut(s) 430
HinfI GANTC 3 cut(s) 100, 394, 412
Hpy166II GTNNAC 3 cut(s) 161, 298, 430
Hpy188I TCNGA 1 cut(s) 35
Hpy188III TCNNGA 7 cut(s) 46, 104, 134, 332, 404, 416, 445
Hpy8I GTNNAC 3 cut(s) 161, 298, 430
Hpy99I CGWCG 2 cut(s) 89, 206
HpyAV CCTTC 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 228
Hsp92II CATG 3 cut(s) 407, 454, 464
Kzo9I GATC 4 cut(s) 28, 150, 224, 453
LmnI GCTCC 2 cut(s) 96, 325
MaeI CTAG 1 cut(s) 350
MaeIII GTNAC 1 cut(s) 76
MalI GATC 4 cut(s) 30, 152, 226, 455
MboI GATC 4 cut(s) 28, 150, 224, 453
MboII GAAGA 3 cut(s) 48, 244, 449
MflI RGATCY 1 cut(s) 224
MhlI GDGCHC 1 cut(s) 93
MluCI AATT 1 cut(s) 440
MmeI TCCRAC 1 cut(s) 321
MnlI CCTC 7 cut(s) 92, 179, 267, 316, 352, 355, 358
MseI TTAA 1 cut(s) 282
MspA1I CMGCKG 1 cut(s) 320
NdeII GATC 4 cut(s) 28, 150, 224, 453
NlaIII CATG 3 cut(s) 407, 454, 464
NmuCI GTSAC 1 cut(s) 76
NspI RCATGY 1 cut(s) 464
PagI TCATGA 1 cut(s) 403
PciI ACATGT 1 cut(s) 460
PcsI WCGNNNNNNNCGW 2 cut(s) 120, 177
PfeI GAWTC 3 cut(s) 100, 394, 412
PscI ACATGT 1 cut(s) 460
Psp124BI GAGCTC 1 cut(s) 93
PspPI GGNCC 1 cut(s) 120
PsuI RGATCY 1 cut(s) 224
SacI GAGCTC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 282
Sau3AI GATC 4 cut(s) 28, 150, 224, 453
Sau96I GGNCC 1 cut(s) 120
SduI GDGCHC 1 cut(s) 93
SetI ASST 3 cut(s) 93, 144, 330
Sse9I AATT 1 cut(s) 440
SsiI CCGC 1 cut(s) 320
SspI AATATT 1 cut(s) 238
SspMI CTAG 1 cut(s) 350
SstI GAGCTC 1 cut(s) 93
TaqI TCGA 5 cut(s) 54, 84, 171, 291, 397
TasI AATT 1 cut(s) 440
TfiI GAWTC 3 cut(s) 100, 394, 412
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TseFI GTSAC 1 cut(s) 76
Tsp45I GTSAC 1 cut(s) 76
TspDTI ATGAA 3 cut(s) 4, 276, 392
TspGWI ACGGA 1 cut(s) 315
XapI RAATTY 1 cut(s) 440
XceI RCATGY 1 cut(s) 464
XspI CTAG 1 cut(s) 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.