AT1G49245

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
18218341 .. 18219269
929 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G49245.1

Sequence Viewer

Length: 225 bp
ATGGCGACTACAACTTCGTCGGATCGCGAATTCGAGCTTGAGAAAGAGATAAAGAGGCAAGAGGTTTCGTTAGATGAATTGAGCAGTCTCTCTTCTTCTCGAAGTATCTACCAGAAAAACGGTAACCTCTTCTTCCTCACATCAGCCGAGAAAGCGAAAATCTCTGCGCAGAAACAACTTGATTACGCTAAATCTGAAATCAACAAGATTCGTTCGCAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.46

Weight (kDa)

9.0

Isoelectric Point (pI)

58.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ASNSD1-SEP PF21975 3 - 71 2e-06 ASNSD1 upstream open reading frame protein
Prefoldin_2 PF01920 12 - 74 6.5e-08 Prefoldin subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 168
AccII CGCG 1 cut(s) 27
AclWI GGATC 1 cut(s) 30
AcsI RAATTY 1 cut(s) 29
AluBI AGCT 1 cut(s) 37
AluI AGCT 1 cut(s) 37
Alw26I GTCTC 1 cut(s) 92
AlwI GGATC 1 cut(s) 30
ApoI RAATTY 1 cut(s) 29
ArsI GACNNNNNNTTYG 1 cut(s) 30
AspLEI GCGC 1 cut(s) 169
BcoDI GTCTC 1 cut(s) 92
BpuEI CTTGAG 1 cut(s) 59
Bsh1236I CGCG 1 cut(s) 27
BsmAI GTCTC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 22
Bsp68I TCGCGA 1 cut(s) 27
BspFNI CGCG 1 cut(s) 27
BspPI GGATC 1 cut(s) 30
BssMI GATC 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 122
Bst6I CTCTTC 2 cut(s) 97, 134
BstEII GGTNACC 1 cut(s) 122
BstFNI CGCG 1 cut(s) 27
BstHHI GCGC 1 cut(s) 169
BstKTI GATC 1 cut(s) 25
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 1 cut(s) 22
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstPI GGTNACC 1 cut(s) 122
BstUI CGCG 1 cut(s) 27
BtuMI TCGCGA 1 cut(s) 27
CfoI GCGC 1 cut(s) 169
CviJI RGCY 2 cut(s) 37, 146
CviKI_1 RGCY 2 cut(s) 37, 146
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eam1104I CTCTTC 2 cut(s) 97, 134
EarI CTCTTC 2 cut(s) 97, 134
Eco91I GGTNACC 1 cut(s) 122
EcoO65I GGTNACC 1 cut(s) 122
EcoRI GAATTC 1 cut(s) 29
FspEI CC 8 cut(s) 5, 40, 47, 105, 125, 140, 149, 160
FspI TGCGCA 1 cut(s) 168
GlaI GCGC 1 cut(s) 168
HhaI GCGC 1 cut(s) 169
Hin6I GCGC 1 cut(s) 167
HinP1I GCGC 1 cut(s) 167
HinfI GANTC 1 cut(s) 208
Hpy188I TCNGA 2 cut(s) 22, 196
Hpy188III TCNNGA 2 cut(s) 26, 99
Hpy99I CGWCG 1 cut(s) 22
HpyCH4III ACNGT 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HspAI GCGC 1 cut(s) 167
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 122
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MboII GAAGA 4 cut(s) 84, 87, 121, 124
MluCI AATT 2 cut(s) 29, 77
MnlI CCTC 4 cut(s) 48, 55, 137, 146
MvnI CGCG 1 cut(s) 27
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 22
NmeAIII GCCGAG 1 cut(s) 172
NruI TCGCGA 1 cut(s) 27
NsbI TGCGCA 1 cut(s) 168
PfeI GAWTC 1 cut(s) 208
PspEI GGTNACC 1 cut(s) 122
RruI TCGCGA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 22
SetI ASST 3 cut(s) 39, 66, 129
SgeI CNNG 9 cut(s) 38, 46, 50, 71, 111, 124, 160, 191, 217
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
Sse9I AATT 2 cut(s) 29, 77
TaaI ACNGT 1 cut(s) 122
TaqI TCGA 2 cut(s) 33, 100
TasI AATT 2 cut(s) 29, 77
TfiI GAWTC 1 cut(s) 208
TspDTI ATGAA 1 cut(s) 90
XapI RAATTY 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.