AT1G67600

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Reverse (-)
25336235 .. 25337747
1513 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G67600.1

Sequence Viewer

Length: 492 bp
ATGGAGGAATCGGTGGCTTCATCTTCCTCGCACTATATCTCAATTTTCACAAATTACCCTCTGATTTCCGCCGTTTTAGCTTTCACCATCGCACAATTCATCAAATTCTTCACCTCCTGGTATAAAGAAAGGAGATGGGATTTGAAACGGCTTGTTGGGTCTGGAGGTATGCCTTCATCACATTCAGCAACGGTTACAGCTTTAGCTTTAGCTGTTGGTTTACAAGAAGGTTTTGGTGGTTCACATTTCGCTATCGCTTTGGTTCTCACTACCATTGTTATGTATGATGCAACTGGTGTAAGGTTACATGCTGGACGCCAAGCTGAGGTTCTAAATCAGATTGTGTATGAACTTCCTGCAGAGCATCCTCTGGCTGAAACCAGACCTTTGCGTGAACTTCTAGGTCATACTCCTCCCCAGGTTATTGCTGGTGGAATGCTTGGAATATCTACAGCAGTTGTTGGGTACTTAGTCATCTTGTTAGCCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

163

Amino Acids

17.6

Weight (kDa)

7.02

Isoelectric Point (pI)

41.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF212 PF02681 17 - 150 1.1e-51 Divergent PAP2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010674)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AcsI RAATTY 1 cut(s) 104
AcyI GRCGYC 1 cut(s) 316
AfaI GTAC 1 cut(s) 467
AfiI CCNNNNNNNGG 1 cut(s) 325
AgsI TTSAA 1 cut(s) 145
AjnI CCWGG 2 cut(s) 116, 417
AjuI GAANNNNNNNTTGG 2 cut(s) 312, 344
AluBI AGCT 5 cut(s) 80, 200, 206, 212, 323
AluI AGCT 5 cut(s) 80, 200, 206, 212, 323
ApoI RAATTY 1 cut(s) 104
AsuHPI GGTGA 2 cut(s) 76, 103
BbvCI CCTCAGC 1 cut(s) 324
BccI CCATC 2 cut(s) 95, 129
BceAI ACGGC 2 cut(s) 56, 164
BciT130I CCWGG 2 cut(s) 118, 419
BfaI CTAG 1 cut(s) 401
BfmI CTRYAG 2 cut(s) 357, 450
Bme1390I CCNGG 2 cut(s) 118, 419
BmrFI CCNGG 2 cut(s) 118, 419
BmsI GCATC 2 cut(s) 277, 373
BpmI CTGGAG 1 cut(s) 183
Bpu10I CCTNAGC 1 cut(s) 324
BsaHI GRCGYC 1 cut(s) 316
BsaJI CCNNGG 1 cut(s) 417
Bsc4I CCNNNNNNNGG 1 cut(s) 325
Bse1I ACTGG 1 cut(s) 298
BseBI CCWGG 2 cut(s) 118, 419
BseDI CCNNGG 1 cut(s) 417
BseGI GGATG 1 cut(s) 364
BseLI CCNNNNNNNGG 1 cut(s) 325
BseMII CTCAG 1 cut(s) 315
BseNI ACTGG 1 cut(s) 298
BseRI GAGGAG 1 cut(s) 402
BslI CCNNNNNNNGG 1 cut(s) 325
BsmI GAATGC 1 cut(s) 441
BspACI CCGC 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 316
BspMAI CTGCAG 1 cut(s) 361
BsrI ACTGG 1 cut(s) 298
BssECI CCNNGG 1 cut(s) 417
BssNI GRCGYC 1 cut(s) 316
Bst2UI CCWGG 2 cut(s) 118, 419
Bst4CI ACNGT 1 cut(s) 193
BstACI GRCGYC 1 cut(s) 316
BstDEI CTNAG 2 cut(s) 324, 469
BstF5I GGATG 1 cut(s) 364
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNI CCWGG 2 cut(s) 118, 419
BstNSI RCATGY 1 cut(s) 311
BstSCI CCNGG 2 cut(s) 116, 417
BstSFI CTRYAG 2 cut(s) 357, 450
BtgZI GCGATG 1 cut(s) 73
BtsCI GGATG 1 cut(s) 364
CseI GACGC 1 cut(s) 324
Csp6I GTAC 1 cut(s) 466
CviAII CATG 1 cut(s) 308
CviJI RGCY 9 cut(s) 17, 80, 151, 200, 206, 212, 323, 374, 485
CviKI_1 RGCY 9 cut(s) 17, 80, 151, 200, 206, 212, 323, 374, 485
CviQI GTAC 1 cut(s) 466
DdeI CTNAG 2 cut(s) 324, 469
EciI GGCGGA 1 cut(s) 58
EcoRII CCWGG 2 cut(s) 116, 417
FaeI CATG 1 cut(s) 311
FaiI YATR 8 cut(s) 36, 123, 170, 281, 285, 309, 348, 408
FatI CATG 1 cut(s) 307
FokI GGATG 1 cut(s) 351
FspBI CTAG 1 cut(s) 401
GsuI CTGGAG 1 cut(s) 183
HgaI GACGC 1 cut(s) 324
Hin1I GRCGYC 1 cut(s) 316
Hin1II CATG 1 cut(s) 311
HinfI GANTC 1 cut(s) 8
HphI GGTGA 2 cut(s) 76, 103
Hpy166II GTNNAC 3 cut(s) 221, 242, 395
Hpy188I TCNGA 2 cut(s) 63, 339
Hpy188III TCNNGA 1 cut(s) 162
Hpy8I GTNNAC 3 cut(s) 221, 242, 395
HpyAV CCTTC 2 cut(s) 183, 221
HpyCH4III ACNGT 1 cut(s) 193
HpyCH4V TGCA 2 cut(s) 290, 359
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpyF3I CTNAG 2 cut(s) 324, 469
Hsp92I GRCGYC 1 cut(s) 316
Hsp92II CATG 1 cut(s) 311
LweI GCATC 2 cut(s) 277, 373
MaeI CTAG 1 cut(s) 401
MaeIII GTNAC 2 cut(s) 193, 303
MboII GAAGA 2 cut(s) 15, 100
MluCI AATT 4 cut(s) 42, 52, 95, 104
MnlI CCTC 7 cut(s) 37, 69, 124, 158, 319, 378, 423
MslI CAYNNNNRTG 1 cut(s) 278
MspR9I CCNGG 2 cut(s) 118, 419
Mva1269I GAATGC 1 cut(s) 441
MvaI CCWGG 2 cut(s) 118, 419
MwoI GCNNNNNNNGC 1 cut(s) 77
NlaIII CATG 1 cut(s) 311
NspI RCATGY 1 cut(s) 311
PctI GAATGC 1 cut(s) 441
PfeI GAWTC 1 cut(s) 8
Psp6I CCWGG 2 cut(s) 116, 417
PspGI CCWGG 2 cut(s) 116, 417
PstI CTGCAG 1 cut(s) 361
RsaI GTAC 1 cut(s) 467
RsaNI GTAC 1 cut(s) 466
RseI CAYNNNNRTG 1 cut(s) 278
ScrFI CCNGG 2 cut(s) 118, 419
SfaNI GCATC 2 cut(s) 277, 373
SfcI CTRYAG 2 cut(s) 357, 450
SmiMI CAYNNNNRTG 1 cut(s) 278
Sse9I AATT 4 cut(s) 42, 52, 95, 104
SsiI CCGC 1 cut(s) 69
SspMI CTAG 1 cut(s) 401
StyD4I CCNGG 2 cut(s) 116, 417
TaaI ACNGT 1 cut(s) 193
TasI AATT 4 cut(s) 42, 52, 95, 104
TfiI GAWTC 1 cut(s) 8
TspDTI ATGAA 4 cut(s) 9, 88, 165, 363
XapI RAATTY 1 cut(s) 104
XceI RCATGY 1 cut(s) 311
XcmI CCANNNNNNNNNTGG 1 cut(s) 425
XspI CTAG 1 cut(s) 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.