AT2G01990

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0009989
Physical Location & Seq
Reverse (-)
464994 .. 466955
1962 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G01990.1

Sequence Viewer

Length: 642 bp
ATGAATAGATCGCCGGAACATATTTTCGGATCACCGGAGATTGATTACTCCGACGTCTCCACAGGTTACCTCGAAGACGCACTTATCGAGTCCGGTGAGAGAAGCAAAAGGAGACGTCTCTTGTTCGAGGATCCGTCCAAATCTTTTAACGATGATGATTCGCAGAACGATTGGGGCCTGCATGAGAGTTATAGCTGTTTGAATAGTCAGTTTGTCACTCCACATGTTAACACAGGTGAACGTATAAGTGGAGTCAGTTACTGTCAGGAGACGATATCGAATGTTTACGAGTCTCCCGACACTTCTGTCTCTTATGACAAAATTTATGTTCGAGAAAAATCTCCAACCGAACCATCCTCATCCAACTGTGGTAATAAGAACAAAAGACTAATCACGAAACTAGTGTACCCATTTGGATTGGTGAAACCAGGTGGTCGAGAAAATGATGTAACCCTAAATGATATCAACGAGAGAATTTTGATGGCTCCATCTCGACCGATTCGACATCCGGTAGGAGACTTTGCCTCTCGACCATGTGTCTCTGGCCGTGGACCGGGCCTCTCCGGAAAAGCTGTGGTGGCTCTTACTAAGATCCAAACACAAGGGAGGGGTACAATTACTATAATCAGAACTAAGGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

213

Amino Acids

23.6

Weight (kDa)

6.9

Isoelectric Point (pI)

54.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009989)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G14630 AT1G14630 AT2G01990 AT2G01990
fragaria_vesca FvH4_4g35920
malus_domestica MD13G1013900.v1.1 MD16G1011100.v1.1
prunus_persica Prupe.1G339600_v2.0.a1 Prupe.1G339600_v2.0.a1
pyrus_communis pycom13g01180 pycom16g01090
rosa_chinensis RchiOBHm_Chr4g0445521
rosa_laevigata RLG00000005733
rosa_multiflora Rmu_ssc0000253.1_g000002
rosa_roxburghii Rroxscaffold_5G00386000
rosa_rugosa Rorug04G0362100
rosa_samantha Rh4AG423600 Rh4BG435600 Rh4CG450300 Rh4DG431900
rosa_wichuraiana Rw4G036310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 305
AatII GACGTC 2 cut(s) 57, 118
AccIII TCCGGA 1 cut(s) 563
AclWI GGATC 4 cut(s) 37, 125, 138, 586
AcoI YGGCCR 1 cut(s) 544
AcsI RAATTY 2 cut(s) 321, 474
AcyI GRCGYC 2 cut(s) 54, 115
AfaI GTAC 2 cut(s) 407, 613
AfiI CCNNNNNNNGG 1 cut(s) 553
AflIII ACRYGT 1 cut(s) 223
AgsI TTSAA 1 cut(s) 202
AhdI GACNNNNNGTC 1 cut(s) 536
AhlI ACTAGT 1 cut(s) 400
AjnI CCWGG 1 cut(s) 427
AluBI AGCT 2 cut(s) 195, 572
AluI AGCT 2 cut(s) 195, 572
Alw26I GTCTC 8 cut(s) 61, 106, 122, 263, 297, 313, 510, 544
AlwI GGATC 4 cut(s) 37, 125, 138, 586
AlwNI CAGNNNCTG 1 cut(s) 261
Aor13HI TCCGGA 1 cut(s) 563
AoxI GGCC 3 cut(s) 175, 544, 556
ApoI RAATTY 2 cut(s) 321, 474
AspS9I GGNCC 3 cut(s) 175, 551, 556
AsuC2I CCSGG 1 cut(s) 555
AsuHPI GGTGA 4 cut(s) 24, 107, 248, 433
AvaII GGWCC 1 cut(s) 551
BaeI ACNNNNGTAYC 2 cut(s) 389, 422
BamHI GGATCC 1 cut(s) 130
BbsI GAAGAC 1 cut(s) 81
BccI CCATC 3 cut(s) 361, 475, 496
BceAI ACGGC 1 cut(s) 531
BciT130I CCWGG 1 cut(s) 429
BcnI CCSGG 1 cut(s) 555
BcoDI GTCTC 8 cut(s) 61, 106, 122, 263, 297, 313, 510, 544
BcuI ACTAGT 1 cut(s) 400
BfaI CTAG 1 cut(s) 401
Bme1390I CCNGG 2 cut(s) 429, 555
Bme18I GGWCC 1 cut(s) 551
BmeRI GACNNNNNGTC 1 cut(s) 536
BmgT120I GGNCC 3 cut(s) 175, 551, 556
BmiI GGNNCC 3 cut(s) 132, 176, 486
BmrFI CCNGG 2 cut(s) 429, 555
BpiI GAAGAC 1 cut(s) 81
BpuMI CCSGG 1 cut(s) 555
BsaHI GRCGYC 2 cut(s) 54, 115
BsaJI CCNNGG 1 cut(s) 547
BsaWI WCCGGW 4 cut(s) 34, 92, 508, 563
Bsc4I CCNNNNNNNGG 1 cut(s) 553
BseAI TCCGGA 1 cut(s) 563
BseBI CCWGG 1 cut(s) 429
BseDI CCNNGG 1 cut(s) 547
BseGI GGATG 3 cut(s) 353, 359, 505
BseLI CCNNNNNNNGG 1 cut(s) 553
Bsh1285I CGRYCG 1 cut(s) 497
BshFI GGCC 3 cut(s) 177, 546, 558
BsiEI CGRYCG 1 cut(s) 497
BsiSI CCGG 6 cut(s) 14, 35, 93, 509, 554, 564
BslI CCNNNNNNNGG 1 cut(s) 553
BsmAI GTCTC 8 cut(s) 61, 106, 122, 263, 297, 313, 510, 544
BsmBI CGTCTC 4 cut(s) 61, 106, 122, 263
BsnI GGCC 3 cut(s) 177, 546, 558
Bsp13I TCCGGA 1 cut(s) 563
Bsp143I GATC 4 cut(s) 8, 29, 130, 591
BspANI GGCC 3 cut(s) 177, 546, 558
BspEI TCCGGA 1 cut(s) 563
BspLI GGNNCC 3 cut(s) 132, 176, 486
BspPI GGATC 4 cut(s) 37, 125, 138, 586
BssECI CCNNGG 1 cut(s) 547
BssMI GATC 4 cut(s) 8, 29, 130, 591
BssNI GRCGYC 2 cut(s) 54, 115
Bst2UI CCWGG 1 cut(s) 429
Bst4CI ACNGT 2 cut(s) 263, 368
BstACI GRCGYC 2 cut(s) 54, 115
BstC8I GCNNGC 1 cut(s) 179
BstDEI CTNAG 2 cut(s) 588, 633
BstDSI CCRYGG 1 cut(s) 547
BstEII GGTNACC 1 cut(s) 65
BstF5I GGATG 3 cut(s) 353, 359, 505
BstKTI GATC 4 cut(s) 11, 32, 133, 594
BstMAI GTCTC 8 cut(s) 61, 106, 122, 263, 297, 313, 510, 544
BstMBI GATC 4 cut(s) 8, 29, 130, 591
BstMCI CGRYCG 1 cut(s) 497
BstMWI GCNNNNNNNGC 1 cut(s) 578
BstNI CCWGG 1 cut(s) 429
BstNSI RCATGY 1 cut(s) 227
BstPI GGTNACC 1 cut(s) 65
BstSCI CCNGG 2 cut(s) 427, 553
BstV2I GAAGAC 1 cut(s) 81
BstX2I RGATCY 2 cut(s) 130, 591
BstYI RGATCY 2 cut(s) 130, 591
BsuRI GGCC 3 cut(s) 177, 546, 558
BtgI CCRYGG 1 cut(s) 547
BtsCI GGATG 3 cut(s) 353, 359, 505
Cac8I GCNNGC 1 cut(s) 179
CaiI CAGNNNCTG 1 cut(s) 261
Cfr13I GGNCC 3 cut(s) 175, 551, 556
CseI GACGC 1 cut(s) 86
CsiI ACCWGGT 1 cut(s) 427
Csp6I GTAC 2 cut(s) 406, 612
CviAII CATG 3 cut(s) 182, 224, 534
CviJI RGCY 7 cut(s) 177, 195, 485, 546, 558, 572, 581
CviKI_1 RGCY 7 cut(s) 177, 195, 485, 546, 558, 572, 581
CviQI GTAC 2 cut(s) 406, 612
DdeI CTNAG 2 cut(s) 588, 633
DpnI GATC 4 cut(s) 10, 31, 132, 593
DpnII GATC 4 cut(s) 8, 29, 130, 591
DrdI GACNNNNNNGTC 1 cut(s) 305
DriI GACNNNNNGTC 1 cut(s) 536
DseDI GACNNNNNNGTC 1 cut(s) 305
EaeI YGGCCR 1 cut(s) 544
Eam1105I GACNNNNNGTC 1 cut(s) 536
Eco32I GATATC 2 cut(s) 276, 463
Eco47I GGWCC 1 cut(s) 551
Eco91I GGTNACC 1 cut(s) 65
EcoO109I RGGNCCY 1 cut(s) 175
EcoO65I GGTNACC 1 cut(s) 65
EcoRII CCWGG 1 cut(s) 427
EcoRV GATATC 2 cut(s) 276, 463
Esp3I CGTCTC 4 cut(s) 61, 106, 122, 263
FaeI CATG 3 cut(s) 185, 227, 537
FaiI YATR 9 cut(s) 21, 183, 192, 225, 245, 315, 327, 535, 623
FalI AAGNNNNNCTT 2 cut(s) 66, 98
FatI CATG 3 cut(s) 181, 223, 533
FokI GGATG 3 cut(s) 340, 346, 492
FspBI CTAG 1 cut(s) 401
HaeIII GGCC 3 cut(s) 177, 546, 558
HapII CCGG 6 cut(s) 14, 35, 93, 509, 554, 564
HgaI GACGC 1 cut(s) 86
Hin1I GRCGYC 2 cut(s) 54, 115
Hin1II CATG 3 cut(s) 185, 227, 537
HincII GTYRAC 1 cut(s) 229
HindII GTYRAC 1 cut(s) 229
HinfI GANTC 5 cut(s) 89, 158, 252, 290, 499
HpaI GTTAAC 1 cut(s) 229
HpaII CCGG 6 cut(s) 14, 35, 93, 509, 554, 564
HphI GGTGA 4 cut(s) 24, 107, 248, 433
Hpy166II GTNNAC 5 cut(s) 229, 239, 286, 406, 551
Hpy188I TCNGA 3 cut(s) 29, 52, 629
Hpy188III TCNNGA 8 cut(s) 266, 296, 332, 394, 437, 492, 528, 564
Hpy8I GTNNAC 5 cut(s) 229, 239, 286, 406, 551
Hpy99I CGWCG 1 cut(s) 56
HpyCH4III ACNGT 2 cut(s) 263, 368
HpyCH4IV ACGT 3 cut(s) 54, 115, 241
HpyCH4V TGCA 1 cut(s) 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 578
HpyF3I CTNAG 2 cut(s) 588, 633
HpySE526I ACGT 3 cut(s) 54, 115, 241
Hsp92I GRCGYC 2 cut(s) 54, 115
Hsp92II CATG 3 cut(s) 185, 227, 537
Kpn2I TCCGGA 1 cut(s) 563
KspAI GTTAAC 1 cut(s) 229
Kzo9I GATC 4 cut(s) 8, 29, 130, 591
LmnI GCTCC 1 cut(s) 490
MabI ACCWGGT 1 cut(s) 427
MaeI CTAG 1 cut(s) 401
MaeII ACGT 3 cut(s) 54, 115, 241
MaeIII GTNAC 4 cut(s) 65, 214, 257, 448
MalI GATC 4 cut(s) 10, 31, 132, 593
MboI GATC 4 cut(s) 8, 29, 130, 591
MboII GAAGA 1 cut(s) 86
MflI RGATCY 2 cut(s) 130, 591
MluCI AATT 3 cut(s) 321, 474, 615
MlyI GAGTC 3 cut(s) 98, 261, 299
MmeI TCCRAC 3 cut(s) 75, 368, 387
MnlI CCTC 6 cut(s) 80, 121, 367, 535, 569, 600
MroI TCCGGA 1 cut(s) 563
MseI TTAA 2 cut(s) 147, 228
MspI CCGG 6 cut(s) 14, 35, 93, 509, 554, 564
MspR9I CCNGG 2 cut(s) 429, 555
MvaI CCWGG 1 cut(s) 429
MwoI GCNNNNNNNGC 1 cut(s) 578
NciI CCSGG 1 cut(s) 555
NdeII GATC 4 cut(s) 8, 29, 130, 591
NlaIII CATG 3 cut(s) 185, 227, 537
NlaIV GGNNCC 3 cut(s) 132, 176, 486
NmuCI GTSAC 1 cut(s) 214
NspI RCATGY 1 cut(s) 227
PciI ACATGT 1 cut(s) 223
PcsI WCGNNNNNNNCGW 3 cut(s) 84, 294, 499
PfeI GAWTC 2 cut(s) 158, 499
PleI GAGTC 3 cut(s) 97, 260, 298
PpsI GAGTC 3 cut(s) 97, 260, 298
PscI ACATGT 1 cut(s) 223
Psp6I CCWGG 1 cut(s) 427
PspEI GGTNACC 1 cut(s) 65
PspGI CCWGG 1 cut(s) 427
PspN4I GGNNCC 3 cut(s) 132, 176, 486
PspPI GGNCC 3 cut(s) 175, 551, 556
PstNI CAGNNNCTG 1 cut(s) 261
PsuI RGATCY 2 cut(s) 130, 591
RsaI GTAC 2 cut(s) 407, 613
RsaNI GTAC 2 cut(s) 406, 612
SaqAI TTAA 2 cut(s) 147, 228
Sau3AI GATC 4 cut(s) 8, 29, 130, 591
Sau96I GGNCC 3 cut(s) 175, 551, 556
SchI GAGTC 3 cut(s) 98, 261, 299
ScrFI CCNGG 2 cut(s) 429, 555
SetI ASST 9 cut(s) 57, 67, 72, 118, 197, 238, 244, 433, 574
SexAI ACCWGGT 1 cut(s) 427
SinI GGWCC 1 cut(s) 551
SpeI ACTAGT 1 cut(s) 400
Sse9I AATT 3 cut(s) 321, 474, 615
SspMI CTAG 1 cut(s) 401
StyD4I CCNGG 2 cut(s) 427, 553
TaaI ACNGT 2 cut(s) 263, 368
TaiI ACGT 3 cut(s) 57, 118, 244
TaqI TCGA 9 cut(s) 72, 87, 126, 278, 331, 436, 493, 502, 529
TaqII GACCGA 1 cut(s) 511
TasI AATT 3 cut(s) 321, 474, 615
TfiI GAWTC 2 cut(s) 158, 499
Tru1I TTAA 2 cut(s) 147, 228
Tru9I TTAA 2 cut(s) 147, 228
TseFI GTSAC 1 cut(s) 214
Tsp45I GTSAC 1 cut(s) 214
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 123
VpaK11BI GGWCC 1 cut(s) 551
XapI RAATTY 2 cut(s) 321, 474
XceI RCATGY 1 cut(s) 227
XspI CTAG 1 cut(s) 401
ZraI GACGTC 2 cut(s) 55, 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.