AT2G19460

Domain of unknown function (DUF3511)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0013231
Physical Location & Seq
Forward (+)
8431363 .. 8432269
907 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G19460.1

Sequence Viewer

Length: 351 bp
ATGGAAGACTACAGATCCAGATCGTACGGTGACGGGAGAACATCAGACCTTCAACAATACTCTGCTCACCGAAGATCCGACGGTCCAGATTCATTCAGTGGTAACGGTATGCAAGATCTTAGGTCTTACAGTACTTCCTACACAGATTACCCGACCCGGATACCCGAAGACCAGAACCCGAAGAAAGGAAGATCATCTTCATCGTCTTCTTGGGGATTTGTGGATCCAGATTTACAAAGGAAGAAGAGAGTTGTTAGTTACAGAGCTTATACTGTTGAAGGTAAGCTTAAAGGTTCTTTCAGAAAAAGCTTCAAATGGATCAAAGATAAATGCAACAAATTACTTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3511

Protein Analysis

116

Amino Acids

13.42

Weight (kDa)

9.77

Isoelectric Point (pI)

46.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3511 PF12023 74 - 114 1.6e-22 Domain of unknown function (DUF3511)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013231)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G19460 AT2G19460
fragaria_vesca FvH4_1g07900
malus_domestica MD02G1082500.v1.1 MD11G1281800.v1.1 MD15G1210400.v1.1
prunus_persica Prupe.7G206300_v2.0.a1
pyrus_communis pycom02g06540 pycom15g18650
rosa_chinensis RchiOBHm_Chr2g0093771
rosa_laevigata RLG00000016435
rosa_multiflora Rmu_sc0012116.1_g000003
rosa_roxburghii Rroxscaffold_2G00147820
rosa_rugosa Rorug02G0039600
rosa_samantha Rh2AG086100 Rh2BG086400 Rh2CG088800 Rh2DG084500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 9, 69, 218, 231, 326
AfaI GTAC 2 cut(s) 26, 133
AfiI CCNNNNNNNGG 1 cut(s) 185
AgsI TTSAA 3 cut(s) 53, 278, 313
AluBI AGCT 3 cut(s) 266, 286, 309
AluI AGCT 3 cut(s) 266, 286, 309
AlwI GGATC 5 cut(s) 9, 69, 218, 231, 326
AspS9I GGNCC 1 cut(s) 83
AsuC2I CCSGG 1 cut(s) 157
AsuHPI GGTGA 2 cut(s) 41, 59
AvaII GGWCC 1 cut(s) 83
BamHI GGATCC 1 cut(s) 223
BbsI GAAGAC 3 cut(s) 12, 174, 198
BciVI GTATCC 1 cut(s) 153
BcnI CCSGG 1 cut(s) 157
BfmI CTRYAG 1 cut(s) 10
BfuI GTATCC 1 cut(s) 153
BglII AGATCT 1 cut(s) 115
BmcAI AGTACT 1 cut(s) 133
Bme1390I CCNGG 1 cut(s) 157
Bme18I GGWCC 1 cut(s) 83
BmgT120I GGNCC 1 cut(s) 83
BmiI GGNNCC 1 cut(s) 225
BmrFI CCNGG 1 cut(s) 157
BpiI GAAGAC 3 cut(s) 12, 174, 198
BpuMI CCSGG 1 cut(s) 157
BsaBI GATNNNNATC 1 cut(s) 19
Bsc4I CCNNNNNNNGG 1 cut(s) 185
Bse8I GATNNNNATC 1 cut(s) 19
BseJI GATNNNNATC 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 185
BsiSI CCGG 1 cut(s) 157
BsiWI CGTACG 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 185
Bsp143I GATC 7 cut(s) 14, 20, 74, 115, 191, 223, 318
BspLI GGNNCC 1 cut(s) 225
BspPI GGATC 5 cut(s) 9, 69, 218, 231, 326
BssMI GATC 7 cut(s) 14, 20, 74, 115, 191, 223, 318
Bst4CI ACNGT 5 cut(s) 29, 83, 107, 131, 274
Bst6I CTCTTC 1 cut(s) 239
BstDEI CTNAG 1 cut(s) 119
BstKTI GATC 7 cut(s) 17, 23, 77, 118, 194, 226, 321
BstMBI GATC 7 cut(s) 14, 20, 74, 115, 191, 223, 318
BstSCI CCNGG 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 10
BstV2I GAAGAC 3 cut(s) 12, 174, 198
BstX2I RGATCY 4 cut(s) 14, 74, 115, 223
BstYI RGATCY 4 cut(s) 14, 74, 115, 223
BsuI GTATCC 1 cut(s) 153
BtsIMutI CAGTG 1 cut(s) 103
Cfr13I GGNCC 1 cut(s) 83
Csp6I GTAC 2 cut(s) 25, 132
CviJI RGCY 3 cut(s) 266, 286, 309
CviKI_1 RGCY 3 cut(s) 266, 286, 309
CviQI GTAC 2 cut(s) 25, 132
DdeI CTNAG 1 cut(s) 119
DpnI GATC 7 cut(s) 16, 22, 76, 117, 193, 225, 320
DpnII GATC 7 cut(s) 14, 20, 74, 115, 191, 223, 318
Eam1104I CTCTTC 1 cut(s) 239
EarI CTCTTC 1 cut(s) 239
Eco47I GGWCC 1 cut(s) 83
FaiI YATR 2 cut(s) 110, 270
FalI AAGNNNNNCTT 4 cut(s) 181, 213, 270, 302
HapII CCGG 1 cut(s) 157
HindIII AAGCTT 2 cut(s) 284, 307
HinfI GANTC 1 cut(s) 89
HpaII CCGG 1 cut(s) 157
HphI GGTGA 2 cut(s) 41, 59
Hpy188I TCNGA 3 cut(s) 46, 79, 302
Hpy188III TCNNGA 3 cut(s) 18, 86, 227
Hpy99I CGWCG 1 cut(s) 83
HpyAV CCTTC 2 cut(s) 59, 272
HpyCH4III ACNGT 5 cut(s) 29, 83, 107, 131, 274
HpyCH4V TGCA 2 cut(s) 112, 333
HpyF3I CTNAG 1 cut(s) 119
Kzo9I GATC 7 cut(s) 14, 20, 74, 115, 191, 223, 318
LpnPI CCDG 5 cut(s) 31, 99, 170, 185, 240
MaeIII GTNAC 3 cut(s) 29, 101, 257
MalI GATC 7 cut(s) 16, 22, 76, 117, 193, 225, 320
MboI GATC 7 cut(s) 14, 20, 74, 115, 191, 223, 318
MboII GAAGA 9 cut(s) 17, 84, 179, 189, 193, 198, 201, 253, 256
MflI RGATCY 4 cut(s) 14, 74, 115, 223
MluCI AATT 2 cut(s) 338, 346
MmeI TCCRAC 1 cut(s) 102
MseI TTAA 3 cut(s) 288, 345, 349
MspI CCGG 1 cut(s) 157
MspR9I CCNGG 1 cut(s) 157
NciI CCSGG 1 cut(s) 157
NdeII GATC 7 cut(s) 14, 20, 74, 115, 191, 223, 318
NlaIV GGNNCC 1 cut(s) 225
NmuCI GTSAC 1 cut(s) 29
PacI TTAATTAA 1 cut(s) 349
PfeI GAWTC 1 cut(s) 89
Pfl23II CGTACG 1 cut(s) 24
PspLI CGTACG 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 225
PspPI GGNCC 1 cut(s) 83
PsuI RGATCY 4 cut(s) 14, 74, 115, 223
RsaI GTAC 2 cut(s) 26, 133
RsaNI GTAC 2 cut(s) 25, 132
SaqAI TTAA 3 cut(s) 288, 345, 349
Sau3AI GATC 7 cut(s) 14, 20, 74, 115, 191, 223, 318
Sau96I GGNCC 1 cut(s) 83
ScaI AGTACT 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 157
SetI ASST 7 cut(s) 51, 125, 268, 283, 288, 295, 311
SfcI CTRYAG 1 cut(s) 10
SinI GGWCC 1 cut(s) 83
Sse9I AATT 2 cut(s) 338, 346
StyD4I CCNGG 1 cut(s) 155
TaaI ACNGT 5 cut(s) 29, 83, 107, 131, 274
TasI AATT 2 cut(s) 338, 346
TatI WGTACW 1 cut(s) 131
TfiI GAWTC 1 cut(s) 89
Tru1I TTAA 3 cut(s) 288, 345, 349
Tru9I TTAA 3 cut(s) 288, 345, 349
TscAI CASTG 1 cut(s) 103
TseFI GTSAC 1 cut(s) 29
Tsp45I GTSAC 1 cut(s) 29
TspDTI ATGAA 2 cut(s) 81, 189
TspRI CASTG 1 cut(s) 103
VpaK11BI GGWCC 1 cut(s) 83
ZrmI AGTACT 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.