AT2G43780

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0009513
Physical Location & Seq
Reverse (-)
18136108 .. 18137803
1696 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G43780.2

Sequence Viewer

Length: 204 bp
ATGGCGGGATTTCCAGGTTTTAGTTACCTAGGCCCAAAAGGCAAGAACACGGTTGTAGCTGGTGGCTTGACAGCTTTTGTTTTTGGGGTATACTTCTACACAATGAGGGCGGTTGGTGGCACAGACGAGCTTCAAGTGGCTATAGACAAGTTCGAAGGCCAAAAACAGGTGGACACTGACACCAAGGTTCCATCTAAGGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.14

Weight (kDa)

8.01

Isoelectric Point (pI)

14.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coa3_cc PF09813 14 - 38 2.8e-07 Cytochrome c oxidase assembly factor 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 90
AciI CCGC 2 cut(s) 5, 110
AfiI CCNNNNNNNGG 1 cut(s) 166
AgsI TTSAA 1 cut(s) 134
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 3 cut(s) 59, 74, 130
AluI AGCT 3 cut(s) 59, 74, 130
AoxI GGCC 2 cut(s) 31, 157
AspA2I CCTAGG 1 cut(s) 28
AspS9I GGNCC 1 cut(s) 32
AsuII TTCGAA 1 cut(s) 153
AvrII CCTAGG 1 cut(s) 28
BccI CCATC 1 cut(s) 199
BciT130I CCWGG 1 cut(s) 15
BfaI CTAG 1 cut(s) 29
BfmI CTRYAG 1 cut(s) 141
BglI GCCNNNNNGGC 1 cut(s) 39
BlnI CCTAGG 1 cut(s) 28
Bme1390I CCNGG 1 cut(s) 15
BmgT120I GGNCC 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 15
Bpu14I TTCGAA 1 cut(s) 153
BsaJI CCNNGG 2 cut(s) 28, 183
Bsc4I CCNNNNNNNGG 1 cut(s) 166
BseBI CCWGG 1 cut(s) 15
BseDI CCNNGG 2 cut(s) 28, 183
BseLI CCNNNNNNNGG 1 cut(s) 166
BshFI GGCC 2 cut(s) 33, 159
BslI CCNNNNNNNGG 1 cut(s) 166
BsnI GGCC 2 cut(s) 33, 159
Bsp119I TTCGAA 1 cut(s) 153
BspACI CCGC 2 cut(s) 5, 110
BspANI GGCC 2 cut(s) 33, 159
BspLI GGNNCC 1 cut(s) 189
BspT104I TTCGAA 1 cut(s) 153
BssECI CCNNGG 2 cut(s) 28, 183
BssNAI GTATAC 1 cut(s) 91
BssT1I CCWWGG 2 cut(s) 28, 183
Bst1107I GTATAC 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 52
BstBI TTCGAA 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 195
BstMWI GCNNNNNNNGC 1 cut(s) 39
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 141
BstZ17I GTATAC 1 cut(s) 91
BsuRI GGCC 2 cut(s) 33, 159
BtsIMutI CAGTG 1 cut(s) 174
Cfr13I GGNCC 1 cut(s) 32
CviJI RGCY 7 cut(s) 33, 59, 66, 74, 130, 140, 159
CviKI_1 RGCY 7 cut(s) 33, 59, 66, 74, 130, 140, 159
DdeI CTNAG 1 cut(s) 195
Eco130I CCWWGG 2 cut(s) 28, 183
EcoRII CCWGG 1 cut(s) 13
EcoT14I CCWWGG 2 cut(s) 28, 183
ErhI CCWWGG 2 cut(s) 28, 183
FaiI YATR 2 cut(s) 91, 143
FblI GTMKAC 1 cut(s) 90
FspBI CTAG 1 cut(s) 29
HaeIII GGCC 2 cut(s) 33, 159
Hpy166II GTNNAC 2 cut(s) 91, 172
Hpy8I GTNNAC 2 cut(s) 91, 172
HpyAV CCTTC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 1 cut(s) 39
HpyF3I CTNAG 1 cut(s) 195
LpnPI CCDG 3 cut(s) 27, 45, 152
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 23
MnlI CCTC 1 cut(s) 99
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
MwoI GCNNNNNNNGC 1 cut(s) 39
NlaIV GGNNCC 1 cut(s) 189
NspV TTCGAA 1 cut(s) 153
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 15
SetI ASST 8 cut(s) 19, 30, 61, 76, 132, 171, 189, 201
SfcI CTRYAG 1 cut(s) 141
SfuI TTCGAA 1 cut(s) 153
SsiI CCGC 2 cut(s) 5, 110
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 13
StyI CCWWGG 2 cut(s) 28, 183
TaaI ACNGT 1 cut(s) 52
TaqI TCGA 1 cut(s) 153
TscAI CASTG 1 cut(s) 181
TspRI CASTG 1 cut(s) 181
XmaJI CCTAGG 1 cut(s) 28
XmiI GTMKAC 1 cut(s) 90
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.