Prupe.4G204500_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Reverse (-)
12732063 .. 12732593
531 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G204500.1

Sequence Viewer

Length: 207 bp
ATGTCTGGGATTTCAGGATATAGGAGCCTTGCACCTAAAACGAAGAATGCTATAGTTGCTGGGGGGCTGTCAGCTTTTGTCTTTGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGCACAGATGAATTGCAAGTGGCTATAAATAAGTTTGAGGAGGAAAAAGGTCAGAAGGAGGCTGAAGCAAGCATGCCATCAGAGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.24

Weight (kDa)

5.26

Isoelectric Point (pI)

49.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 201
AluBI AGCT 2 cut(s) 74, 110
AluI AGCT 2 cut(s) 74, 110
BccI CCATC 1 cut(s) 202
BfmI CTRYAG 1 cut(s) 51
BmiI GGNNCC 1 cut(s) 26
BseRI GAGGAG 1 cut(s) 170
BseYI CCCAGC 1 cut(s) 59
BsmI GAATGC 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 26
BstC8I GCNNGC 2 cut(s) 187, 191
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstNSI RCATGY 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 51
Cac8I GCNNGC 2 cut(s) 187, 191
CviAII CATG 2 cut(s) 103, 190
CviJI RGCY 7 cut(s) 27, 67, 74, 110, 140, 179, 203
CviKI_1 RGCY 7 cut(s) 27, 67, 74, 110, 140, 179, 203
Eco57I CTGAAG 1 cut(s) 201
FaeI CATG 2 cut(s) 106, 193
FaiI YATR 6 cut(s) 21, 53, 91, 104, 143, 191
FatI CATG 2 cut(s) 102, 189
GsaI CCCAGC 1 cut(s) 63
Hin1II CATG 2 cut(s) 106, 193
Hpy188I TCNGA 2 cut(s) 171, 199
Hpy188III TCNNGA 1 cut(s) 15
HpyAV CCTTC 1 cut(s) 166
HpyCH4V TGCA 2 cut(s) 32, 133
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
Hsp92II CATG 2 cut(s) 106, 193
LmnI GCTCC 1 cut(s) 24
LpnPI CCDG 1 cut(s) 45
MboII GAAGA 1 cut(s) 55
MluCI AATT 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 5 cut(s) 110, 148, 151, 169, 193
Mva1269I GAATGC 1 cut(s) 52
MwoI GCNNNNNNNGC 1 cut(s) 56
NlaIII CATG 2 cut(s) 106, 193
NlaIV GGNNCC 1 cut(s) 26
NspI RCATGY 1 cut(s) 193
PaeI GCATGC 1 cut(s) 193
PctI GAATGC 1 cut(s) 52
PspFI CCCAGC 1 cut(s) 59
PspN4I GGNNCC 1 cut(s) 26
SetI ASST 4 cut(s) 37, 76, 112, 169
SfcI CTRYAG 1 cut(s) 51
SgeI CNNG 8 cut(s) 18, 27, 41, 72, 115, 146, 198, 202
SphI GCATGC 1 cut(s) 193
Sse9I AATT 1 cut(s) 128
TasI AATT 1 cut(s) 128
TspDTI ATGAA 1 cut(s) 141
XceI RCATGY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.