Rmu_sc0001200.1_g000019

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001200.1
Physical Location & Seq
Reverse (-)
130057 .. 131402
1346 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001200.1_g000019.1.cds

Sequence Viewer

Length: 231 bp
atggctgggatttcgggatttaggagccttgcacctaaaacaaagaatgttatagttgctgggggcttgacagcttttgtctttggcgtgtacttctacaccatgagagctgttggaggtacagatgaactacaagtggccatagataagtttgagggagacaaagtccagaaacaggctgaaggaagcatgccgtcaaaggatagttggaatcctgtaaagccacaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.17

Weight (kDa)

9.1

Isoelectric Point (pI)

38.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 138
AcuI CTGAAG 1 cut(s) 201
AfaI GTAC 2 cut(s) 92, 121
AfiI CCNNNNNNNGG 1 cut(s) 175
AluBI AGCT 2 cut(s) 74, 110
AluI AGCT 2 cut(s) 74, 110
Alw26I GTCTC 1 cut(s) 153
AoxI GGCC 1 cut(s) 138
BalI TGGCCA 1 cut(s) 140
BceAI ACGGC 1 cut(s) 178
BcoDI GTCTC 1 cut(s) 153
BmiI GGNNCC 1 cut(s) 26
BsaXI ACNNNNNCTCC 2 cut(s) 150, 180
Bsc4I CCNNNNNNNGG 1 cut(s) 175
BseLI CCNNNNNNNGG 1 cut(s) 175
BseYI CCCAGC 2 cut(s) 5, 59
BshFI GGCC 1 cut(s) 140
BslI CCNNNNNNNGG 1 cut(s) 175
BsmAI GTCTC 1 cut(s) 153
BsnI GGCC 1 cut(s) 140
BspANI GGCC 1 cut(s) 140
BspLI GGNNCC 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 191
BstMAI GTCTC 1 cut(s) 153
BstNSI RCATGY 1 cut(s) 193
BsuRI GGCC 1 cut(s) 140
Cac8I GCNNGC 1 cut(s) 191
Csp6I GTAC 2 cut(s) 91, 120
CviAII CATG 2 cut(s) 103, 190
CviJI RGCY 8 cut(s) 5, 27, 66, 74, 110, 140, 179, 223
CviKI_1 RGCY 8 cut(s) 5, 27, 66, 74, 110, 140, 179, 223
CviQI GTAC 2 cut(s) 91, 120
EaeI YGGCCR 1 cut(s) 138
Eco57I CTGAAG 1 cut(s) 201
FaeI CATG 2 cut(s) 106, 193
FaiI YATR 4 cut(s) 53, 104, 143, 191
FatI CATG 2 cut(s) 102, 189
GsaI CCCAGC 2 cut(s) 9, 63
HaeIII GGCC 1 cut(s) 140
Hin1II CATG 2 cut(s) 106, 193
HinfI GANTC 1 cut(s) 211
Hpy166II GTNNAC 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 15, 169
Hpy8I GTNNAC 1 cut(s) 91
HpyAV CCTTC 1 cut(s) 176
HpyCH4V TGCA 1 cut(s) 32
Hsp92II CATG 2 cut(s) 106, 193
LmnI GCTCC 1 cut(s) 24
LpnPI CCDG 3 cut(s) 45, 161, 182
MlsI TGGCCA 1 cut(s) 140
MluNI TGGCCA 1 cut(s) 140
MmeI TCCRAC 2 cut(s) 94, 188
MnlI CCTC 2 cut(s) 110, 148
Mox20I TGGCCA 1 cut(s) 140
MscI TGGCCA 1 cut(s) 140
Msp20I TGGCCA 1 cut(s) 140
NlaIII CATG 2 cut(s) 106, 193
NlaIV GGNNCC 1 cut(s) 26
NspI RCATGY 1 cut(s) 193
PaeI GCATGC 1 cut(s) 193
PfeI GAWTC 1 cut(s) 211
PflFI GACNNNGTC 1 cut(s) 164
PspFI CCCAGC 2 cut(s) 5, 59
PspN4I GGNNCC 1 cut(s) 26
PsyI GACNNNGTC 1 cut(s) 164
RsaI GTAC 2 cut(s) 92, 121
RsaNI GTAC 2 cut(s) 91, 120
SetI ASST 4 cut(s) 37, 76, 112, 121
SphI GCATGC 1 cut(s) 193
TatI WGTACW 1 cut(s) 90
TfiI GAWTC 1 cut(s) 211
TspDTI ATGAA 1 cut(s) 141
Tth111I GACNNNGTC 1 cut(s) 164
XceI RCATGY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.