Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr7

Orthogroup ID

OG0009513

Physical Location & Seq

Genomic Coordinates Forward (+)

52640913 .. 52641077

Gene Structure 165 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw7G035310.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 165 bp

ATGGCTGGGATTTCGGGATTTAGGAGCCGTGCACCTAGAACAAAGAATGTTATAGTTGCTGGGGGCTTGACAACTTTTGTCTTTGGCGTGTACTTCTACACCATGAGAGCTGTTGGAGGTACAGATGAACTACAAGTGGCTATAGATAAGTTTGAAGGAGACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

54

Amino Acids

5.82

Weight (kDa)

8.19

Isoelectric Point (pI)

31.28

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Coa3_cc	PF09813	8 - 38	4.9e-09	Cytochrome c oxidase assembly factor 3

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009513)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43780 AT2G43780 AT2G43780 AT2G43780
fragaria_vesca	FvH4_6g21131
malus_domestica	MD03G1210800.v1.1 MD11G1225700.v1.1
prunus_persica	Prupe.4G204500_v2.0.a1
pyrus_communis	pycom03g15940 pycom13g28910
rosa_chinensis	RchiOBHm_Chr4g0405791 RchiOBHm_Chr7g0232231
rosa_multiflora	Rmu_sc0001200.1_g000019
rosa_roxburghii	Rroxscaffold_5G00350280
rosa_rugosa	Rorug04G0062200 Rorug04G0062200
rosa_samantha	Rh4BG128900 Rh4CG141600 Rh4DG128200 Rh7AG426100
rosa_wichuraiana	Rw4G010880 Rw7G035310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	2 cut(s)	92, 121
AgsI	TTSAA	1 cut(s)	155
AluBI	AGCT	1 cut(s)	110
AluI	AGCT	1 cut(s)	110
Alw21I	GWGCWC	1 cut(s)	34
Alw26I	GTCTC	1 cut(s)	153
Alw44I	GTGCAC	1 cut(s)	30
ApaLI	GTGCAC	1 cut(s)	30
BaeGI	GKGCMC	1 cut(s)	34
Bbv12I	GWGCWC	1 cut(s)	34
BceAI	ACGGC	1 cut(s)	12
BcoDI	GTCTC	1 cut(s)	153
BfaI	CTAG	1 cut(s)	36
BfmI	CTRYAG	1 cut(s)	141
BmiI	GGNNCC	1 cut(s)	26
BseSI	GKGCMC	1 cut(s)	34
BseYI	CCCAGC	2 cut(s)	5, 59
BsiHKAI	GWGCWC	1 cut(s)	34
BsmAI	GTCTC	1 cut(s)	153
Bsp1286I	GDGCHC	1 cut(s)	34
BspLI	GGNNCC	1 cut(s)	26
BstMAI	GTCTC	1 cut(s)	153
BstSFI	CTRYAG	1 cut(s)	141
BstSLI	GKGCMC	1 cut(s)	34
Csp6I	GTAC	2 cut(s)	91, 120
CviAII	CATG	1 cut(s)	103
CviJI	RGCY	5 cut(s)	5, 27, 66, 110, 140
CviKI_1	RGCY	5 cut(s)	5, 27, 66, 110, 140
CviQI	GTAC	2 cut(s)	91, 120
FaeI	CATG	1 cut(s)	106
FaiI	YATR	3 cut(s)	53, 104, 143
FatI	CATG	1 cut(s)	102
FspBI	CTAG	1 cut(s)	36
GsaI	CCCAGC	2 cut(s)	9, 63
Hin1II	CATG	1 cut(s)	106
Hpy166II	GTNNAC	2 cut(s)	32, 91
Hpy188III	TCNNGA	1 cut(s)	15
Hpy8I	GTNNAC	2 cut(s)	32, 91
HpyAV	CCTTC	1 cut(s)	149
HpyCH4V	TGCA	1 cut(s)	32
Hsp92II	CATG	1 cut(s)	106
LmnI	GCTCC	1 cut(s)	24
LpnPI	CCDG	1 cut(s)	45
MaeI	CTAG	1 cut(s)	36
MhlI	GDGCHC	1 cut(s)	34
MmeI	TCCRAC	1 cut(s)	94
MnlI	CCTC	1 cut(s)	110
NlaIII	CATG	1 cut(s)	106
NlaIV	GGNNCC	1 cut(s)	26
PspFI	CCCAGC	2 cut(s)	5, 59
PspN4I	GGNNCC	1 cut(s)	26
RsaI	GTAC	2 cut(s)	92, 121
RsaNI	GTAC	2 cut(s)	91, 120
SduI	GDGCHC	1 cut(s)	34
SetI	ASST	3 cut(s)	37, 112, 121
SfcI	CTRYAG	1 cut(s)	141
SgeI	CNNG	9 cut(s)	18, 27, 41, 48, 72, 79, 100, 115, 146
SspMI	CTAG	1 cut(s)	36
TatI	WGTACW	1 cut(s)	90
TspDTI	ATGAA	1 cut(s)	141
VneI	GTGCAC	1 cut(s)	30
XspI	CTAG	1 cut(s)	36

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.