Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr11

Orthogroup ID

OG0009513

Physical Location & Seq

Genomic Coordinates Forward (+)

32991500 .. 32993930

Gene Structure 2431 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD11G1225700.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 207 bp

ATGGCTGGGATTTCGGGATTTAGGAGCCTTGCACCTAAAACAAAGAATGCTATCGTTGCAGGGGGCTTGTCAGCTTTTGTTTTCGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGCACAGATGAACTACAGGTGGCTATAAACAAATTTGAGGAGGAAAAAGTTCAGAAAGGGGCTGAAGCAAACGTGGCATCAAAGGTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

69

Amino Acids

7.17

Weight (kDa)

9.16

Isoelectric Point (pI)

32.69

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Coa3_cc	PF09813	13 - 38	4.3e-08	Cytochrome c oxidase assembly factor 3

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009513)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43780 AT2G43780 AT2G43780 AT2G43780
fragaria_vesca	FvH4_6g21131
malus_domestica	MD03G1210800.v1.1 MD11G1225700.v1.1
prunus_persica	Prupe.4G204500_v2.0.a1
pyrus_communis	pycom03g15940 pycom13g28910
rosa_chinensis	RchiOBHm_Chr4g0405791 RchiOBHm_Chr7g0232231
rosa_multiflora	Rmu_sc0001200.1_g000019
rosa_roxburghii	Rroxscaffold_5G00350280
rosa_rugosa	Rorug04G0062200 Rorug04G0062200
rosa_samantha	Rh4BG128900 Rh4CG141600 Rh4DG128200 Rh7AG426100
rosa_wichuraiana	Rw4G010880 Rw7G035310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	149
AcuI	CTGAAG	1 cut(s)	201
AluBI	AGCT	2 cut(s)	74, 110
AluI	AGCT	2 cut(s)	74, 110
ApoI	RAATTY	1 cut(s)	149
Asp700I	GAANNNNTTC	1 cut(s)	165
BfmI	CTRYAG	1 cut(s)	131
BmiI	GGNNCC	1 cut(s)	26
BmsI	GCATC	1 cut(s)	203
BseRI	GAGGAG	1 cut(s)	170
BseYI	CCCAGC	1 cut(s)	5
BsmI	GAATGC	1 cut(s)	52
BspLI	GGNNCC	1 cut(s)	26
BstMWI	GCNNNNNNNGC	2 cut(s)	56, 191
BstSFI	CTRYAG	1 cut(s)	131
CviAII	CATG	1 cut(s)	103
CviJI	RGCY	7 cut(s)	5, 27, 66, 74, 110, 140, 179
CviKI_1	RGCY	7 cut(s)	5, 27, 66, 74, 110, 140, 179
Eco57I	CTGAAG	1 cut(s)	201
FaeI	CATG	1 cut(s)	106
FaiI	YATR	3 cut(s)	91, 104, 143
FatI	CATG	1 cut(s)	102
GsaI	CCCAGC	1 cut(s)	9
Hin1II	CATG	1 cut(s)	106
Hpy188I	TCNGA	2 cut(s)	86, 171
Hpy188III	TCNNGA	1 cut(s)	15
HpyCH4IV	ACGT	1 cut(s)	189
HpyCH4V	TGCA	2 cut(s)	32, 59
HpyF10VI	GCNNNNNNNGC	2 cut(s)	56, 191
HpySE526I	ACGT	1 cut(s)	189
Hsp92II	CATG	1 cut(s)	106
LmnI	GCTCC	1 cut(s)	24
LpnPI	CCDG	2 cut(s)	45, 119
LweI	GCATC	1 cut(s)	203
MaeII	ACGT	1 cut(s)	189
MluCI	AATT	1 cut(s)	149
MmeI	TCCRAC	1 cut(s)	94
MnlI	CCTC	3 cut(s)	110, 148, 151
MroXI	GAANNNNTTC	1 cut(s)	165
Mva1269I	GAATGC	1 cut(s)	52
MwoI	GCNNNNNNNGC	2 cut(s)	56, 191
NlaIII	CATG	1 cut(s)	106
NlaIV	GGNNCC	1 cut(s)	26
PctI	GAATGC	1 cut(s)	52
PdmI	GAANNNNTTC	1 cut(s)	165
PspFI	CCCAGC	1 cut(s)	5
PspN4I	GGNNCC	1 cut(s)	26
SetI	ASST	6 cut(s)	37, 76, 112, 138, 192, 204
SfaNI	GCATC	1 cut(s)	203
SfcI	CTRYAG	1 cut(s)	131
SgeI	CNNG	8 cut(s)	18, 27, 41, 72, 79, 115, 146, 202
Sse9I	AATT	1 cut(s)	149
TaiI	ACGT	1 cut(s)	192
TasI	AATT	1 cut(s)	149
TspDTI	ATGAA	1 cut(s)	141
XapI	RAATTY	1 cut(s)	149
XmnI	GAANNNNTTC	1 cut(s)	165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.