RchiOBHm_Chr7g0232231

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
56220418 .. 56220624
207 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20814

Sequence Viewer

Length: 207 bp
ATGGCTGGGATTTCGGGATTTAGGAGCCTTGCACCTAAAACAAAGAATGTTATAGTTGCTGGGGGCTTGACAACTTTTGTCTTTGGCGTGTACTTCTACACCATGAGAGCTGTTGGAGGTATAGATGAACTACAAGTGGCTATAGATAAGTTTGAAGGAGACAAAGTCCAGAAACAGGCTGAAGGAAGCATGCCGTCAAAGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.26

Weight (kDa)

9.16

Isoelectric Point (pI)

34.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coa3_cc PF09813 13 - 38 1.4e-07 Cytochrome c oxidase assembly factor 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 201
AfaI GTAC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 175
AgsI TTSAA 1 cut(s) 155
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
Alw26I GTCTC 1 cut(s) 153
BceAI ACGGC 1 cut(s) 178
BcoDI GTCTC 1 cut(s) 153
BfmI CTRYAG 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 26
BsaXI ACNNNNNCTCC 2 cut(s) 150, 180
Bsc4I CCNNNNNNNGG 1 cut(s) 175
BseLI CCNNNNNNNGG 1 cut(s) 175
BseYI CCCAGC 2 cut(s) 5, 59
BslI CCNNNNNNNGG 1 cut(s) 175
BsmAI GTCTC 1 cut(s) 153
BspLI GGNNCC 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 191
BstMAI GTCTC 1 cut(s) 153
BstNSI RCATGY 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 141
Cac8I GCNNGC 1 cut(s) 191
Csp6I GTAC 1 cut(s) 91
CviAII CATG 2 cut(s) 103, 190
CviJI RGCY 6 cut(s) 5, 27, 66, 110, 140, 179
CviKI_1 RGCY 6 cut(s) 5, 27, 66, 110, 140, 179
CviQI GTAC 1 cut(s) 91
Eco57I CTGAAG 1 cut(s) 201
FaeI CATG 2 cut(s) 106, 193
FaiI YATR 5 cut(s) 53, 104, 122, 143, 191
FatI CATG 2 cut(s) 102, 189
GsaI CCCAGC 2 cut(s) 9, 63
Hin1II CATG 2 cut(s) 106, 193
Hpy166II GTNNAC 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 15, 169
Hpy8I GTNNAC 1 cut(s) 91
HpyAV CCTTC 2 cut(s) 149, 176
HpyCH4V TGCA 1 cut(s) 32
Hsp92II CATG 2 cut(s) 106, 193
LmnI GCTCC 1 cut(s) 24
LpnPI CCDG 3 cut(s) 45, 161, 182
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 1 cut(s) 110
NlaIII CATG 2 cut(s) 106, 193
NlaIV GGNNCC 1 cut(s) 26
NspI RCATGY 1 cut(s) 193
PaeI GCATGC 1 cut(s) 193
PflFI GACNNNGTC 1 cut(s) 164
PspFI CCCAGC 2 cut(s) 5, 59
PspN4I GGNNCC 1 cut(s) 26
PsyI GACNNNGTC 1 cut(s) 164
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SetI ASST 4 cut(s) 37, 112, 121, 204
SfcI CTRYAG 1 cut(s) 141
SphI GCATGC 1 cut(s) 193
TatI WGTACW 1 cut(s) 90
TspDTI ATGAA 1 cut(s) 141
Tth111I GACNNNGTC 1 cut(s) 164
XceI RCATGY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.