pycom03g15940

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0009513
Physical Location & Seq
Forward (+)
17173271 .. 17173477
207 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g15940.1

Sequence Viewer

Length: 207 bp
ATGGCTGGGATGTCAGGATTTAGGAGCCTTGCACCTAAAACAAAGAATGCTATAGTTGCTGGGGGACTGTCAGCTTTTGTTTTCGGAGTATATTTCTACACCATGAGAGCTGTTGGAGGCACCGATGAATTACAAGTGGCTATAAACAAGTTTGAGGAGGAAAAAGGTCAGAAAGAGGCTGAAGCAAGCTTGTCATCAAAGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.22

Weight (kDa)

8.04

Isoelectric Point (pI)

45.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coa3_cc PF09813 13 - 38 4.3e-08 Cytochrome c oxidase assembly factor 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 119
AcuI CTGAAG 1 cut(s) 201
AluBI AGCT 3 cut(s) 74, 110, 189
AluI AGCT 3 cut(s) 74, 110, 189
BanI GGYRCC 1 cut(s) 119
BfmI CTRYAG 1 cut(s) 51
BmiI GGNNCC 2 cut(s) 26, 121
BseGI GGATG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 170
BseYI CCCAGC 2 cut(s) 5, 59
BshNI GGYRCC 1 cut(s) 119
BslFI GGGAC 1 cut(s) 78
BsmFI GGGAC 1 cut(s) 78
BsmI GAATGC 1 cut(s) 52
BspLI GGNNCC 2 cut(s) 26, 121
BspT107I GGYRCC 1 cut(s) 119
Bst4CI ACNGT 1 cut(s) 69
BstC8I GCNNGC 1 cut(s) 187
BstF5I GGATG 1 cut(s) 15
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstSFI CTRYAG 1 cut(s) 51
BtsCI GGATG 1 cut(s) 15
Cac8I GCNNGC 1 cut(s) 187
CviAII CATG 1 cut(s) 103
CviJI RGCY 7 cut(s) 5, 27, 74, 110, 140, 179, 189
CviKI_1 RGCY 7 cut(s) 5, 27, 74, 110, 140, 179, 189
Eco57I CTGAAG 1 cut(s) 201
FaeI CATG 1 cut(s) 106
FaiI YATR 4 cut(s) 53, 91, 104, 143
FaqI GGGAC 1 cut(s) 78
FatI CATG 1 cut(s) 102
FokI GGATG 1 cut(s) 22
GsaI CCCAGC 2 cut(s) 9, 63
Hin1II CATG 1 cut(s) 106
HindIII AAGCTT 1 cut(s) 187
Hpy188I TCNGA 2 cut(s) 86, 171
Hpy188III TCNNGA 1 cut(s) 15
HpyCH4III ACNGT 1 cut(s) 69
HpyCH4V TGCA 1 cut(s) 32
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
Hsp92II CATG 1 cut(s) 106
LmnI GCTCC 1 cut(s) 24
LpnPI CCDG 1 cut(s) 45
MluCI AATT 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 4 cut(s) 110, 148, 151, 169
Mva1269I GAATGC 1 cut(s) 52
MwoI GCNNNNNNNGC 1 cut(s) 56
NlaIII CATG 1 cut(s) 106
NlaIV GGNNCC 2 cut(s) 26, 121
PctI GAATGC 1 cut(s) 52
PspFI CCCAGC 2 cut(s) 5, 59
PspN4I GGNNCC 2 cut(s) 26, 121
SetI ASST 6 cut(s) 37, 76, 112, 169, 191, 204
SfcI CTRYAG 1 cut(s) 51
SgeI CNNG 9 cut(s) 18, 27, 41, 72, 115, 146, 160, 198, 202
Sse9I AATT 1 cut(s) 128
TaaI ACNGT 1 cut(s) 69
TasI AATT 1 cut(s) 128
TspDTI ATGAA 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.