AT2G45695

Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2- thiolation reaction by being thiocarboxylated (-COSH) at its C- terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
18825954 .. 18826899
946 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G45695.1

Sequence Viewer

Length: 306 bp
ATGCAATTAACTCTTGAATTCGGGGGTGGGTTAGAGCTGCTCTGTGATTCTGAAAAGATTCATAAAGTAAACGTTGATTTGCCCAATGGAGCTGACTCTGATGATTTTACCATGAAGCATTTGCTTTCATGGGTTCGTACAAATCTGATCAAAGAGAGACCTGAGATGTTCATGAAAGGAGATACTGTGAGACCTGGGGTTCTTGTGCTGGTGAATGACTGTGATTGGGAGCTAAGTGGTCAGCTCGATACAGTAATCGAAGATAAAGATGTTGTAGTTTTCATTTCCACTTTGCATGGTGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.29

Weight (kDa)

4.52

Isoelectric Point (pI)

23.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Urm1 PF09138 3 - 101 1.3e-38 Urm1 (Ubiquitin related modifier)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016072)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 72
AcsI RAATTY 1 cut(s) 17
AfaI GTAC 1 cut(s) 139
AgsI TTSAA 1 cut(s) 17
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 4 cut(s) 37, 92, 232, 244
AluI AGCT 4 cut(s) 37, 92, 232, 244
Alw26I GTCTC 2 cut(s) 151, 184
ApeKI GCWGC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 17
Asp700I GAANNNNTTC 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 223
BbvI GCAGC 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 195
BclI TGATCA 1 cut(s) 147
BcoDI GTCTC 2 cut(s) 151, 184
BisI GCNGC 1 cut(s) 38
BlsI GCNGC 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 195
BsaI GGTCTC 2 cut(s) 151, 184
BsaJI CCNNGG 1 cut(s) 194
BsaXI ACNNNNNCTCC 2 cut(s) 171, 201
BseBI CCWGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 194
BseMII CTCAG 1 cut(s) 153
BseXI GCAGC 1 cut(s) 24
BsmAI GTCTC 2 cut(s) 151, 184
Bso31I GGTCTC 2 cut(s) 151, 184
Bsp143I GATC 1 cut(s) 147
BspCNI CTCAG 1 cut(s) 154
BspHI TCATGA 1 cut(s) 171
BspTNI GGTCTC 2 cut(s) 151, 184
BssECI CCNNGG 1 cut(s) 194
BssMI GATC 1 cut(s) 147
Bst2UI CCWGG 1 cut(s) 195
Bst4CI ACNGT 3 cut(s) 187, 221, 253
BstDEI CTNAG 2 cut(s) 162, 233
BstKTI GATC 1 cut(s) 150
BstMAI GTCTC 2 cut(s) 151, 184
BstMBI GATC 1 cut(s) 147
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
BstV1I GCAGC 1 cut(s) 24
CciI TCATGA 1 cut(s) 171
Csp6I GTAC 1 cut(s) 138
CviAII CATG 4 cut(s) 112, 129, 172, 296
CviJI RGCY 4 cut(s) 37, 92, 232, 244
CviKI_1 RGCY 4 cut(s) 37, 92, 232, 244
CviQI GTAC 1 cut(s) 138
DdeI CTNAG 2 cut(s) 162, 233
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
Eco31I GGTCTC 2 cut(s) 151, 184
EcoRI GAATTC 1 cut(s) 17
EcoRII CCWGG 1 cut(s) 193
FaeI CATG 4 cut(s) 115, 132, 175, 299
FaiI YATR 5 cut(s) 63, 113, 130, 173, 297
FatI CATG 4 cut(s) 111, 128, 171, 295
FbaI TGATCA 1 cut(s) 147
Fnu4HI GCNGC 1 cut(s) 38
Fsp4HI GCNGC 1 cut(s) 38
GluI GCNGC 1 cut(s) 38
Hin1II CATG 4 cut(s) 115, 132, 175, 299
HinfI GANTC 3 cut(s) 47, 58, 95
HphI GGTGA 1 cut(s) 223
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 3 cut(s) 52, 100, 147
Hpy188III TCNNGA 2 cut(s) 14, 172
Hpy8I GTNNAC 1 cut(s) 70
HpyCH4III ACNGT 3 cut(s) 187, 221, 253
HpyCH4IV ACGT 1 cut(s) 72
HpyCH4V TGCA 2 cut(s) 4, 295
HpyF3I CTNAG 2 cut(s) 162, 233
HpySE526I ACGT 1 cut(s) 72
Hsp92II CATG 4 cut(s) 115, 132, 175, 299
Ksp22I TGATCA 1 cut(s) 147
Kzo9I GATC 1 cut(s) 147
LmnI GCTCC 2 cut(s) 89, 229
LpnPI CCDG 4 cut(s) 174, 180, 194, 207
Lsp1109I GCAGC 1 cut(s) 24
MaeII ACGT 1 cut(s) 72
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MboII GAAGA 1 cut(s) 272
MluCI AATT 2 cut(s) 5, 17
MlyI GAGTC 1 cut(s) 89
MroXI GAANNNNTTC 1 cut(s) 57
MseI TTAA 1 cut(s) 8
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NdeII GATC 1 cut(s) 147
NlaIII CATG 4 cut(s) 115, 132, 175, 299
PagI TCATGA 1 cut(s) 171
PdmI GAANNNNTTC 1 cut(s) 57
PfeI GAWTC 2 cut(s) 47, 58
PkrI GCNGC 1 cut(s) 39
PleI GAGTC 1 cut(s) 89
PpsI GAGTC 1 cut(s) 89
Psp1406I AACGTT 1 cut(s) 72
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SaqAI TTAA 1 cut(s) 8
SatI GCNGC 1 cut(s) 38
Sau3AI GATC 1 cut(s) 147
SchI GAGTC 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 195
SetI ASST 7 cut(s) 39, 75, 94, 163, 196, 234, 246
Sse9I AATT 2 cut(s) 5, 17
StyD4I CCNGG 1 cut(s) 193
TaaI ACNGT 3 cut(s) 187, 221, 253
TaiI ACGT 1 cut(s) 75
TaqI TCGA 2 cut(s) 246, 258
TasI AATT 2 cut(s) 5, 17
TfiI GAWTC 2 cut(s) 47, 58
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TseI GCWGC 1 cut(s) 37
TspDTI ATGAA 6 cut(s) 50, 117, 128, 160, 188, 271
XapI RAATTY 1 cut(s) 17
XmnI GAANNNNTTC 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.