FvH4_1g27190

Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2- thiolation reaction by being thiocarboxylated (-COSH) at its C- terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
18942035 .. 18943984
1950 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g27190.t1

Sequence Viewer

Length: 396 bp
ATGCTTGATCGTGCACTTTTAATTAATACCTTTAAATTGTTATACACTTTTCTTTTGATAGCCAGAAATCCCACAAACTTTTGCAGCCTTTCCAGTATGCAGCTGACTGTAGAATTCGGCGGAGGATTAGAACTTCTTTGTAACTCTGTCAAGATTCATAATGTCAATGTAGAACTGCAAAAGTCAGCAGAAAAGTTAACCATGAAAGATTTACTTGCTTGGATTCGTACTAATTTGATCAAGGAGAGACCTGAAATGTTTATGAAAGGAGATTCTGTGAGACCTGGTGTTCTGGCCCTTGTGAATGATTGTGATTGGGAGCTGACTGGTCAACTTGATACGACGTTAGAGGAGAAGGACGTGGTTGTGTTCATATCAACCTTGCACGGGGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.74

Weight (kDa)

5.34

Isoelectric Point (pI)

18.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Urm1 PF09138 35 - 131 1.9e-37 Urm1 (Ubiquitin related modifier)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016072)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 120
AcsI RAATTY 1 cut(s) 113
AfaI GTAC 1 cut(s) 229
AfiI CCNNNNNNNGG 1 cut(s) 387
AjiI CACGTC 1 cut(s) 361
AjnI CCWGG 1 cut(s) 283
AluBI AGCT 2 cut(s) 103, 322
AluI AGCT 2 cut(s) 103, 322
Alw21I GWGCWC 1 cut(s) 16
Alw26I GTCTC 2 cut(s) 241, 274
Alw44I GTGCAC 1 cut(s) 12
AoxI GGCC 1 cut(s) 294
ApaLI GTGCAC 1 cut(s) 12
ApeKI GCWGC 2 cut(s) 84, 100
ApoI RAATTY 1 cut(s) 113
AseI ATTAAT 1 cut(s) 24
AspS9I GGNCC 1 cut(s) 295
BaeGI GKGCMC 1 cut(s) 16
Bbv12I GWGCWC 1 cut(s) 16
BbvI GCAGC 2 cut(s) 96, 112
BciT130I CCWGG 1 cut(s) 285
BclI TGATCA 1 cut(s) 237
BcoDI GTCTC 2 cut(s) 241, 274
BfmI CTRYAG 1 cut(s) 108
BisI GCNGC 2 cut(s) 85, 101
BlsI GCNGC 2 cut(s) 86, 102
Bme1390I CCNGG 1 cut(s) 285
BmgBI CACGTC 1 cut(s) 361
BmgT120I GGNCC 1 cut(s) 295
BmrFI CCNGG 1 cut(s) 285
BsaI GGTCTC 2 cut(s) 241, 274
BsaXI ACNNNNNCTCC 2 cut(s) 261, 291
Bsc4I CCNNNNNNNGG 1 cut(s) 387
Bse1I ACTGG 2 cut(s) 93, 331
BseBI CCWGG 1 cut(s) 285
BseLI CCNNNNNNNGG 1 cut(s) 387
BseNI ACTGG 2 cut(s) 93, 331
BseRI GAGGAG 1 cut(s) 365
BseSI GKGCMC 1 cut(s) 16
BseXI GCAGC 2 cut(s) 96, 112
BshFI GGCC 1 cut(s) 296
BsiHKAI GWGCWC 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 387
BsmAI GTCTC 2 cut(s) 241, 274
BsnI GGCC 1 cut(s) 296
Bso31I GGTCTC 2 cut(s) 241, 274
Bsp1286I GDGCHC 1 cut(s) 16
Bsp143I GATC 2 cut(s) 7, 237
BspACI CCGC 1 cut(s) 120
BspANI GGCC 1 cut(s) 296
BspTNI GGTCTC 2 cut(s) 241, 274
BsrI ACTGG 2 cut(s) 93, 331
BssMI GATC 2 cut(s) 7, 237
Bst2UI CCWGG 1 cut(s) 285
Bst4CI ACNGT 1 cut(s) 109
BstKTI GATC 2 cut(s) 10, 240
BstMAI GTCTC 2 cut(s) 241, 274
BstMBI GATC 2 cut(s) 7, 237
BstNI CCWGG 1 cut(s) 285
BstSCI CCNGG 1 cut(s) 283
BstSFI CTRYAG 1 cut(s) 108
BstSLI GKGCMC 1 cut(s) 16
BstV1I GCAGC 2 cut(s) 96, 112
BsuRI GGCC 1 cut(s) 296
BtrI CACGTC 1 cut(s) 361
Cfr13I GGNCC 1 cut(s) 295
CsiI ACCWGGT 1 cut(s) 283
Csp6I GTAC 1 cut(s) 228
CviAII CATG 1 cut(s) 202
CviJI RGCY 5 cut(s) 62, 87, 103, 296, 322
CviKI_1 RGCY 5 cut(s) 62, 87, 103, 296, 322
CviQI GTAC 1 cut(s) 228
DpnI GATC 2 cut(s) 9, 239
DpnII GATC 2 cut(s) 7, 237
DraI TTTAAA 1 cut(s) 34
EciI GGCGGA 1 cut(s) 135
Eco31I GGTCTC 2 cut(s) 241, 274
EcoRI GAATTC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 283
FaeI CATG 1 cut(s) 205
FaiI YATR 6 cut(s) 43, 98, 159, 203, 263, 374
FalI AAGNNNNNCTT 2 cut(s) 198, 230
FatI CATG 1 cut(s) 201
FbaI TGATCA 1 cut(s) 237
Fnu4HI GCNGC 2 cut(s) 85, 101
Fsp4HI GCNGC 2 cut(s) 85, 101
GluI GCNGC 2 cut(s) 85, 101
HaeIII GGCC 1 cut(s) 296
Hin1II CATG 1 cut(s) 205
HincII GTYRAC 2 cut(s) 198, 332
HindII GTYRAC 2 cut(s) 198, 332
HinfI GANTC 3 cut(s) 154, 223, 272
HpaI GTTAAC 1 cut(s) 198
Hpy166II GTNNAC 3 cut(s) 14, 198, 332
Hpy188III TCNNGA 1 cut(s) 151
Hpy8I GTNNAC 3 cut(s) 14, 198, 332
Hpy99I CGWCG 1 cut(s) 346
HpyAV CCTTC 1 cut(s) 349
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4IV ACGT 2 cut(s) 344, 360
HpyCH4V TGCA 5 cut(s) 14, 84, 100, 178, 385
HpySE526I ACGT 2 cut(s) 344, 360
Hsp92II CATG 1 cut(s) 205
Ksp22I TGATCA 1 cut(s) 237
KspAI GTTAAC 1 cut(s) 198
Kzo9I GATC 2 cut(s) 7, 237
LmnI GCTCC 1 cut(s) 319
LpnPI CCDG 7 cut(s) 76, 106, 264, 270, 278, 297, 312
Lsp1109I GCAGC 2 cut(s) 96, 112
MabI ACCWGGT 1 cut(s) 283
MaeII ACGT 2 cut(s) 344, 360
MaeIII GTNAC 1 cut(s) 140
MalI GATC 2 cut(s) 9, 239
MboI GATC 2 cut(s) 7, 237
MhlI GDGCHC 1 cut(s) 16
MluCI AATT 4 cut(s) 21, 35, 113, 232
MnlI CCTC 2 cut(s) 116, 343
MseI TTAA 4 cut(s) 20, 24, 33, 197
MspA1I CMGCKG 1 cut(s) 103
MspR9I CCNGG 1 cut(s) 285
MvaI CCWGG 1 cut(s) 285
NdeII GATC 2 cut(s) 7, 237
NlaIII CATG 1 cut(s) 205
PacI TTAATTAA 1 cut(s) 24
PfeI GAWTC 3 cut(s) 154, 223, 272
PkrI GCNGC 2 cut(s) 86, 102
PshBI ATTAAT 1 cut(s) 24
Psp6I CCWGG 1 cut(s) 283
PspGI CCWGG 1 cut(s) 283
PspPI GGNCC 1 cut(s) 295
PvuII CAGCTG 1 cut(s) 103
RsaI GTAC 1 cut(s) 229
RsaNI GTAC 1 cut(s) 228
SaqAI TTAA 4 cut(s) 20, 24, 33, 197
SatI GCNGC 2 cut(s) 85, 101
Sau3AI GATC 2 cut(s) 7, 237
Sau96I GGNCC 1 cut(s) 295
ScrFI CCNGG 1 cut(s) 285
SduI GDGCHC 1 cut(s) 16
SetI ASST 8 cut(s) 32, 105, 253, 286, 324, 347, 363, 383
SexAI ACCWGGT 1 cut(s) 283
SfcI CTRYAG 1 cut(s) 108
Sse9I AATT 4 cut(s) 21, 35, 113, 232
SsiI CCGC 1 cut(s) 120
StyD4I CCNGG 1 cut(s) 283
TaaI ACNGT 1 cut(s) 109
TaiI ACGT 2 cut(s) 347, 363
TasI AATT 4 cut(s) 21, 35, 113, 232
TfiI GAWTC 3 cut(s) 154, 223, 272
Tru1I TTAA 4 cut(s) 20, 24, 33, 197
Tru9I TTAA 4 cut(s) 20, 24, 33, 197
TseI GCWGC 2 cut(s) 84, 100
TspDTI ATGAA 4 cut(s) 146, 218, 278, 361
VneI GTGCAC 1 cut(s) 12
VspI ATTAAT 1 cut(s) 24
XapI RAATTY 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.