RLG00000022999

Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2- thiolation reaction by being thiocarboxylated (-COSH) at its C- terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
OG0016072
Physical Location & Seq
Reverse (-)
16462660 .. 16466340
3681 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000022999

Sequence Viewer

Length: 486 bp
ATGGTGGCTCGGTTGAGAGGCTGGTGCGCGTTTTCTTCATGGGCTGAGGAGATTGGTGCTGGGTCGGCTGCAGTGGAAGACTTTTCTAATAACTTCACAATCGGAAGGCTCGCTGGGCTTAAAAGGGAGAATACAAGAGCGATTTGCACCAGAGAAAGCCCCAGAAACCTCTGCAGTCTTTCCAGTATGCAGCTGACCGTAGAATTCGGTGGAGGATTAGAGCTTCTTTGTAACTCTGTCAAGATTCATAATGTCAATGTAGAACTGCAAAAGGCAGCAGAAAAGTTAACCATGAAAGATTTACTGGCTTGGATTCATACTAATTTGATCAAGGAGAGGCCTGAAATGTTTATGAAAGGAGATTCTGTGAGACCTGGTGTTCTAGCCCTTGTGAATGATTGTGATTGGGAGCTGACTGGTCAACTTGATACAACACTAGAGGAGAAGGATGTGGTTGTTTTCATTTCAACCTTGCACGGCGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04122 map04122
Pfam Domains
Protein Families
Urm1

Protein Analysis

162

Amino Acids

17.78

Weight (kDa)

5.42

Isoelectric Point (pI)

31.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Urm1 PF09138 65 - 161 4.7e-37 Urm1 (Ubiquitin related modifier)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016072)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G45695 AT3G61113
fragaria_vesca FvH4_1g27190
malus_domestica MD04G1046600.v1.1
prunus_persica Prupe.1G200200_v2.0.a1 Prupe.1G200200_v2.0.a1 Prupe.1G200200_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0487581
rosa_laevigata RLG00000022999
rosa_multiflora Rmu_sc0012412.1_g000002
rosa_roxburghii Rroxscaffold_6G00394690
rosa_rugosa Rorug03G0234100 Rorug03G0234200
rosa_samantha Rh3BG318600 Rh3DG314700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 29
AciI CCGC 1 cut(s) 480
AcsI RAATTY 1 cut(s) 203
AgsI TTSAA 1 cut(s) 468
AjnI CCWGG 1 cut(s) 373
AluBI AGCT 3 cut(s) 193, 223, 412
AluI AGCT 3 cut(s) 193, 223, 412
Alw26I GTCTC 1 cut(s) 364
AoxI GGCC 1 cut(s) 338
ApeKI GCWGC 3 cut(s) 68, 190, 275
ApoI RAATTY 1 cut(s) 203
AspLEI GCGC 1 cut(s) 29
BbsI GAAGAC 1 cut(s) 84
BbvCI CCTCAGC 1 cut(s) 45
BbvI GCAGC 3 cut(s) 55, 202, 287
BciT130I CCWGG 1 cut(s) 375
BclI TGATCA 1 cut(s) 327
BcoDI GTCTC 1 cut(s) 364
BfaI CTAG 2 cut(s) 383, 437
BfmI CTRYAG 2 cut(s) 69, 172
BisI GCNGC 3 cut(s) 69, 191, 276
BlsI GCNGC 3 cut(s) 70, 192, 277
Bme1390I CCNGG 1 cut(s) 375
BmrFI CCNGG 1 cut(s) 375
BpiI GAAGAC 1 cut(s) 84
Bpu10I CCTNAGC 1 cut(s) 45
BsaI GGTCTC 1 cut(s) 364
BsaXI ACNNNNNCTCC 2 cut(s) 351, 381
Bse1I ACTGG 3 cut(s) 183, 309, 421
BseBI CCWGG 1 cut(s) 375
BseGI GGATG 1 cut(s) 454
BseMII CTCAG 1 cut(s) 36
BseNI ACTGG 3 cut(s) 183, 309, 421
BseRI GAGGAG 2 cut(s) 62, 455
BseXI GCAGC 3 cut(s) 55, 202, 287
BseYI CCCAGC 2 cut(s) 59, 113
Bsh1236I CGCG 1 cut(s) 29
BshFI GGCC 1 cut(s) 340
BsmAI GTCTC 1 cut(s) 364
BsnI GGCC 1 cut(s) 340
Bso31I GGTCTC 1 cut(s) 364
Bsp143I GATC 1 cut(s) 327
BspACI CCGC 1 cut(s) 480
BspANI GGCC 1 cut(s) 340
BspCNI CTCAG 1 cut(s) 37
BspFNI CGCG 1 cut(s) 29
BspMAI CTGCAG 2 cut(s) 73, 176
BspTNI GGTCTC 1 cut(s) 364
BsrI ACTGG 3 cut(s) 183, 309, 421
BssMI GATC 1 cut(s) 327
Bst2UI CCWGG 1 cut(s) 375
Bst4CI ACNGT 1 cut(s) 199
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 45
BstF5I GGATG 1 cut(s) 454
BstFNI CGCG 1 cut(s) 29
BstHHI GCGC 1 cut(s) 29
BstKTI GATC 1 cut(s) 330
BstMAI GTCTC 1 cut(s) 364
BstMBI GATC 1 cut(s) 327
BstMWI GCNNNNNNNGC 2 cut(s) 65, 115
BstNI CCWGG 1 cut(s) 375
BstSCI CCNGG 1 cut(s) 373
BstSFI CTRYAG 2 cut(s) 69, 172
BstUI CGCG 1 cut(s) 29
BstV1I GCAGC 3 cut(s) 55, 202, 287
BstV2I GAAGAC 1 cut(s) 84
BsuRI GGCC 1 cut(s) 340
BtsCI GGATG 1 cut(s) 454
BtsI GCAGTG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 78
Cac8I GCNNGC 1 cut(s) 111
CfoI GCGC 1 cut(s) 29
CsiI ACCWGGT 1 cut(s) 373
CviAII CATG 2 cut(s) 39, 292
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 329
DpnII GATC 1 cut(s) 327
Eco147I AGGCCT 1 cut(s) 340
Eco31I GGTCTC 1 cut(s) 364
EcoRI GAATTC 1 cut(s) 203
EcoRII CCWGG 1 cut(s) 373
FaeI CATG 2 cut(s) 42, 295
FaiI YATR 6 cut(s) 40, 188, 249, 293, 318, 353
FatI CATG 2 cut(s) 38, 291
FbaI TGATCA 1 cut(s) 327
Fnu4HI GCNGC 3 cut(s) 69, 191, 276
FokI GGATG 1 cut(s) 461
Fsp4HI GCNGC 3 cut(s) 69, 191, 276
FspBI CTAG 2 cut(s) 383, 437
GlaI GCGC 1 cut(s) 28
GluI GCNGC 3 cut(s) 69, 191, 276
GsaI CCCAGC 2 cut(s) 63, 117
HaeIII GGCC 1 cut(s) 340
HhaI GCGC 1 cut(s) 29
Hin1II CATG 2 cut(s) 42, 295
Hin6I GCGC 1 cut(s) 27
HinP1I GCGC 1 cut(s) 27
HincII GTYRAC 2 cut(s) 288, 422
HindII GTYRAC 2 cut(s) 288, 422
HinfI GANTC 3 cut(s) 244, 313, 362
HpaI GTTAAC 1 cut(s) 288
Hpy166II GTNNAC 2 cut(s) 288, 422
Hpy188I TCNGA 1 cut(s) 104
Hpy188III TCNNGA 1 cut(s) 241
Hpy8I GTNNAC 2 cut(s) 288, 422
HpyAV CCTTC 2 cut(s) 99, 439
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4V TGCA 6 cut(s) 71, 147, 174, 190, 268, 475
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 115
HpyF3I CTNAG 1 cut(s) 45
Hsp92II CATG 2 cut(s) 42, 295
HspAI GCGC 1 cut(s) 27
Ksp22I TGATCA 1 cut(s) 327
KspAI GTTAAC 1 cut(s) 288
Kzo9I GATC 1 cut(s) 327
LmnI GCTCC 1 cut(s) 409
Lsp1109I GCAGC 3 cut(s) 55, 202, 287
MabI ACCWGGT 1 cut(s) 373
MaeI CTAG 2 cut(s) 383, 437
MaeIII GTNAC 1 cut(s) 230
MalI GATC 1 cut(s) 329
MboI GATC 1 cut(s) 327
MboII GAAGA 2 cut(s) 27, 89
MluCI AATT 2 cut(s) 203, 322
MnlI CCTC 6 cut(s) 11, 40, 179, 206, 330, 433
MseI TTAA 2 cut(s) 120, 287
MspA1I CMGCKG 1 cut(s) 193
MspR9I CCNGG 1 cut(s) 375
MvaI CCWGG 1 cut(s) 375
MvnI CGCG 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 65, 115
NdeII GATC 1 cut(s) 327
NlaIII CATG 2 cut(s) 42, 295
PceI AGGCCT 1 cut(s) 340
PfeI GAWTC 3 cut(s) 244, 313, 362
PkrI GCNGC 3 cut(s) 70, 192, 277
Psp6I CCWGG 1 cut(s) 373
PspFI CCCAGC 2 cut(s) 59, 113
PspGI CCWGG 1 cut(s) 373
PstI CTGCAG 2 cut(s) 73, 176
PvuII CAGCTG 1 cut(s) 193
SaqAI TTAA 2 cut(s) 120, 287
SatI GCNGC 3 cut(s) 69, 191, 276
Sau3AI GATC 1 cut(s) 327
ScrFI CCNGG 1 cut(s) 375
SetI ASST 6 cut(s) 171, 195, 225, 376, 414, 473
SexAI ACCWGGT 1 cut(s) 373
SfcI CTRYAG 2 cut(s) 69, 172
Sse9I AATT 2 cut(s) 203, 322
SseBI AGGCCT 1 cut(s) 340
SsiI CCGC 1 cut(s) 480
SspMI CTAG 2 cut(s) 383, 437
StuI AGGCCT 1 cut(s) 340
StyD4I CCNGG 1 cut(s) 373
TaaI ACNGT 1 cut(s) 199
TasI AATT 2 cut(s) 203, 322
TfiI GAWTC 3 cut(s) 244, 313, 362
Tru1I TTAA 2 cut(s) 120, 287
Tru9I TTAA 2 cut(s) 120, 287
TscAI CASTG 1 cut(s) 78
TseI GCWGC 3 cut(s) 68, 190, 275
TspDTI ATGAA 6 cut(s) 27, 236, 305, 308, 368, 451
TspRI CASTG 1 cut(s) 78
XapI RAATTY 1 cut(s) 203
XspI CTAG 2 cut(s) 383, 437
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.