Prupe.1G200200_v2.0.a1

Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2- thiolation reaction by being thiocarboxylated (-COSH) at its C- terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0016072
Physical Location & Seq
Forward (+)
19571294 .. 19573736
2443 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G200200.3

Sequence Viewer

Length: 345 bp
ATGCTGCTGTTTCTTCTGGTTTCGAAACTCTGCAGATTTTCCGATATGAAGCTGACCGTCGAATTCGGCGGAGGATTAGAGCTTCTTTGCAACTCTGTAAAGATTCATAATGTCAATGTAGAACTGCAAAGCGGAGCAGAAAAGTTAACAATGAAGGATTTGCTCTCTTGGATTCGTACCAATTTGATCAAGGAGAGGCCTGAAATGTTTATGAAAGGAGATACTGTGAGACCTGGTGTTCTGGCCCTTGTGAACGATTGCGATTGGGAGCTGAGTGGCCAACTTGATACAACACTAGAGGAGAAGGATGTGGTTGTTTTCATTTCAACCTTACATGGTGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04122 map04122
Pfam Domains
Protein Families
Urm1

Protein Analysis

115

Amino Acids

12.78

Weight (kDa)

5.1

Isoelectric Point (pI)

22.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016072)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G45695 AT3G61113
fragaria_vesca FvH4_1g27190
malus_domestica MD04G1046600.v1.1
prunus_persica Prupe.1G200200_v2.0.a1 Prupe.1G200200_v2.0.a1 Prupe.1G200200_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0487581
rosa_laevigata RLG00000022999
rosa_multiflora Rmu_sc0012412.1_g000002
rosa_roxburghii Rroxscaffold_6G00394690
rosa_rugosa Rorug03G0234100 Rorug03G0234200
rosa_samantha Rh3BG318600 Rh3DG314700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 69, 132
AcoI YGGCCR 1 cut(s) 277
AcsI RAATTY 1 cut(s) 62
AfaI GTAC 1 cut(s) 178
AgsI TTSAA 1 cut(s) 327
AjnI CCWGG 1 cut(s) 232
AluBI AGCT 3 cut(s) 52, 82, 271
AluI AGCT 3 cut(s) 52, 82, 271
Alw26I GTCTC 1 cut(s) 223
AoxI GGCC 3 cut(s) 197, 243, 277
ApeKI GCWGC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 244
AsuII TTCGAA 1 cut(s) 23
BalI TGGCCA 1 cut(s) 279
BciT130I CCWGG 1 cut(s) 234
BclI TGATCA 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 223
BfaI CTAG 1 cut(s) 296
BfmI CTRYAG 1 cut(s) 31
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 234
BmgT120I GGNCC 1 cut(s) 244
BmrFI CCNGG 1 cut(s) 234
Bpu14I TTCGAA 1 cut(s) 23
BsaI GGTCTC 1 cut(s) 223
BsaXI ACNNNNNCTCC 2 cut(s) 210, 240
BseBI CCWGG 1 cut(s) 234
BseGI GGATG 1 cut(s) 313
BseMII CTCAG 1 cut(s) 263
BseRI GAGGAG 1 cut(s) 314
BshFI GGCC 3 cut(s) 199, 245, 279
BsmAI GTCTC 1 cut(s) 223
BsnI GGCC 3 cut(s) 199, 245, 279
Bso31I GGTCTC 1 cut(s) 223
Bsp119I TTCGAA 1 cut(s) 23
Bsp143I GATC 1 cut(s) 186
BspACI CCGC 2 cut(s) 69, 132
BspANI GGCC 3 cut(s) 199, 245, 279
BspCNI CTCAG 1 cut(s) 264
BspMAI CTGCAG 1 cut(s) 35
BspT104I TTCGAA 1 cut(s) 23
BspTNI GGTCTC 1 cut(s) 223
BssMI GATC 1 cut(s) 186
Bst2UI CCWGG 1 cut(s) 234
Bst4CI ACNGT 2 cut(s) 58, 226
BstBI TTCGAA 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 272
BstF5I GGATG 1 cut(s) 313
BstKTI GATC 1 cut(s) 189
BstMAI GTCTC 1 cut(s) 223
BstMBI GATC 1 cut(s) 186
BstNI CCWGG 1 cut(s) 234
BstSCI CCNGG 1 cut(s) 232
BstSFI CTRYAG 1 cut(s) 31
BsuRI GGCC 3 cut(s) 199, 245, 279
BtsCI GGATG 1 cut(s) 313
Cfr13I GGNCC 1 cut(s) 244
CsiI ACCWGGT 1 cut(s) 232
Csp6I GTAC 1 cut(s) 177
CviAII CATG 1 cut(s) 335
CviJI RGCY 6 cut(s) 52, 82, 199, 245, 271, 279
CviKI_1 RGCY 6 cut(s) 52, 82, 199, 245, 271, 279
CviQI GTAC 1 cut(s) 177
DdeI CTNAG 1 cut(s) 272
DpnI GATC 1 cut(s) 188
DpnII GATC 1 cut(s) 186
EaeI YGGCCR 1 cut(s) 277
EciI GGCGGA 1 cut(s) 84
Eco147I AGGCCT 1 cut(s) 199
Eco31I GGTCTC 1 cut(s) 223
EcoRI GAATTC 1 cut(s) 62
EcoRII CCWGG 1 cut(s) 232
FaeI CATG 1 cut(s) 338
FaiI YATR 4 cut(s) 47, 108, 212, 336
FatI CATG 1 cut(s) 334
FbaI TGATCA 1 cut(s) 186
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 1 cut(s) 320
Fsp4HI GCNGC 1 cut(s) 5
FspBI CTAG 1 cut(s) 296
GluI GCNGC 1 cut(s) 5
HaeIII GGCC 3 cut(s) 199, 245, 279
Hin1II CATG 1 cut(s) 338
HincII GTYRAC 1 cut(s) 147
HindII GTYRAC 1 cut(s) 147
HinfI GANTC 2 cut(s) 103, 172
HpaI GTTAAC 1 cut(s) 147
Hpy166II GTNNAC 2 cut(s) 147, 253
Hpy188I TCNGA 1 cut(s) 43
Hpy8I GTNNAC 2 cut(s) 147, 253
Hpy99I CGWCG 1 cut(s) 62
HpyAV CCTTC 2 cut(s) 148, 298
HpyCH4III ACNGT 2 cut(s) 58, 226
HpyCH4V TGCA 3 cut(s) 33, 90, 127
HpyF3I CTNAG 1 cut(s) 272
Hsp92II CATG 1 cut(s) 338
Ksp22I TGATCA 1 cut(s) 186
KspAI GTTAAC 1 cut(s) 147
Kzo9I GATC 1 cut(s) 186
LmnI GCTCC 2 cut(s) 134, 268
LpnPI CCDG 5 cut(s) 2, 213, 219, 227, 246
MabI ACCWGGT 1 cut(s) 232
MaeI CTAG 1 cut(s) 296
MalI GATC 1 cut(s) 188
MboI GATC 1 cut(s) 186
MboII GAAGA 1 cut(s) 5
MlsI TGGCCA 1 cut(s) 279
MluCI AATT 2 cut(s) 62, 181
MluNI TGGCCA 1 cut(s) 279
MnlI CCTC 3 cut(s) 65, 189, 292
Mox20I TGGCCA 1 cut(s) 279
MscI TGGCCA 1 cut(s) 279
MseI TTAA 1 cut(s) 146
Msp20I TGGCCA 1 cut(s) 279
MspR9I CCNGG 1 cut(s) 234
MvaI CCWGG 1 cut(s) 234
NdeII GATC 1 cut(s) 186
NlaIII CATG 1 cut(s) 338
NspV TTCGAA 1 cut(s) 23
PceI AGGCCT 1 cut(s) 199
PfeI GAWTC 2 cut(s) 103, 172
PkrI GCNGC 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
PspPI GGNCC 1 cut(s) 244
PstI CTGCAG 1 cut(s) 35
RsaI GTAC 1 cut(s) 178
RsaNI GTAC 1 cut(s) 177
SaqAI TTAA 1 cut(s) 146
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 1 cut(s) 186
Sau96I GGNCC 1 cut(s) 244
ScrFI CCNGG 1 cut(s) 234
SetI ASST 5 cut(s) 54, 84, 235, 273, 332
SexAI ACCWGGT 1 cut(s) 232
SfcI CTRYAG 1 cut(s) 31
SfuI TTCGAA 1 cut(s) 23
Sse9I AATT 2 cut(s) 62, 181
SseBI AGGCCT 1 cut(s) 199
SsiI CCGC 2 cut(s) 69, 132
SspMI CTAG 1 cut(s) 296
StuI AGGCCT 1 cut(s) 199
StyD4I CCNGG 1 cut(s) 232
TaaI ACNGT 2 cut(s) 58, 226
TaqI TCGA 2 cut(s) 23, 60
TasI AATT 2 cut(s) 62, 181
TfiI GAWTC 2 cut(s) 103, 172
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TseI GCWGC 1 cut(s) 4
TspDTI ATGAA 5 cut(s) 62, 95, 167, 227, 310
XapI RAATTY 1 cut(s) 62
XspI CTAG 1 cut(s) 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.