AT3G61113

Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2- thiolation reaction by being thiocarboxylated (-COSH) at its C- terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0016072
Physical Location & Seq
Reverse (-)
22614385 .. 22615577
1193 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G61113.1

Sequence Viewer

Length: 300 bp
ATGCAATTTACTCTTGAGTTCGGTGGAGGTTTAGAATTGCTCTGTGACTCCGTAAAGATTCATAAAGTTAACATCAACTTACTCAATGATTCTGATATCTTGACAATGAAGGATTTGCTTTCATGGGTTCGTACCAATTTGATCAAGGAAAGGCCTGAAATGTTCATGAAAGGCGATACCGTGAGGCCTGGAGTTCTCGTGCTGGTTAATGACTGCGATTGGGAACTTAGTGGTCAGCTCGATACAACATTAGAAGATAAAGATGTTATAGTTTTCATTTCGACTCTGCACGGTGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04122 map04122
Pfam Domains
Protein Families
Urm1

Protein Analysis

99

Amino Acids

11.15

Weight (kDa)

4.56

Isoelectric Point (pI)

25.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Urm1 PF09138 3 - 99 1.4e-37 Urm1 (Ubiquitin related modifier)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016072)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G45695 AT3G61113
fragaria_vesca FvH4_1g27190
malus_domestica MD04G1046600.v1.1
prunus_persica Prupe.1G200200_v2.0.a1 Prupe.1G200200_v2.0.a1 Prupe.1G200200_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0487581
rosa_laevigata RLG00000022999
rosa_multiflora Rmu_sc0012412.1_g000002
rosa_roxburghii Rroxscaffold_6G00394690
rosa_rugosa Rorug03G0234100 Rorug03G0234200
rosa_samantha Rh3BG318600 Rh3DG314700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 133
AjnI CCWGG 1 cut(s) 187
AluBI AGCT 1 cut(s) 238
AluI AGCT 1 cut(s) 238
AoxI GGCC 2 cut(s) 152, 185
BauI CACGAG 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 189
BclI TGATCA 1 cut(s) 141
Bme1390I CCNGG 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 189
BpmI CTGGAG 1 cut(s) 210
BpuEI CTTGAG 1 cut(s) 35
BsaXI ACNNNNNCTCC 2 cut(s) 183, 213
BseBI CCWGG 1 cut(s) 189
BsgI GTGCAG 1 cut(s) 272
BshFI GGCC 2 cut(s) 154, 187
BsnI GGCC 2 cut(s) 154, 187
Bsp143I GATC 1 cut(s) 141
BspANI GGCC 2 cut(s) 154, 187
BspHI TCATGA 1 cut(s) 165
BssMI GATC 1 cut(s) 141
BssSI CACGAG 1 cut(s) 197
Bst2BI CACGAG 1 cut(s) 197
Bst2UI CCWGG 1 cut(s) 189
Bst4CI ACNGT 2 cut(s) 181, 293
BstDEI CTNAG 1 cut(s) 227
BstKTI GATC 1 cut(s) 144
BstMBI GATC 1 cut(s) 141
BstNI CCWGG 1 cut(s) 189
BstSCI CCNGG 1 cut(s) 187
BsuRI GGCC 2 cut(s) 154, 187
CciI TCATGA 1 cut(s) 165
Csp6I GTAC 1 cut(s) 132
CviAII CATG 2 cut(s) 123, 166
CviJI RGCY 3 cut(s) 154, 187, 238
CviKI_1 RGCY 3 cut(s) 154, 187, 238
CviQI GTAC 1 cut(s) 132
DdeI CTNAG 1 cut(s) 227
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
Eco147I AGGCCT 2 cut(s) 154, 187
Eco32I GATATC 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 187
EcoRV GATATC 1 cut(s) 97
FaeI CATG 2 cut(s) 126, 169
FaiI YATR 4 cut(s) 63, 124, 167, 269
FatI CATG 2 cut(s) 122, 165
FbaI TGATCA 1 cut(s) 141
GsuI CTGGAG 1 cut(s) 210
HaeIII GGCC 2 cut(s) 154, 187
Hin1II CATG 2 cut(s) 126, 169
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
HinfI GANTC 4 cut(s) 47, 58, 89, 283
HpaI GTTAAC 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 94
Hpy188III TCNNGA 3 cut(s) 14, 100, 166
Hpy8I GTNNAC 1 cut(s) 70
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 2 cut(s) 181, 293
HpyCH4V TGCA 2 cut(s) 4, 289
HpyF3I CTNAG 1 cut(s) 227
Hsp92II CATG 2 cut(s) 126, 169
Ksp22I TGATCA 1 cut(s) 141
KspAI GTTAAC 1 cut(s) 70
Kzo9I GATC 1 cut(s) 141
LpnPI CCDG 4 cut(s) 168, 174, 188, 201
MaeIII GTNAC 1 cut(s) 44
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MboII GAAGA 1 cut(s) 266
MluCI AATT 3 cut(s) 5, 35, 136
MlyI GAGTC 2 cut(s) 41, 277
MnlI CCTC 2 cut(s) 20, 177
MseI TTAA 2 cut(s) 69, 207
MspR9I CCNGG 1 cut(s) 189
MvaI CCWGG 1 cut(s) 189
NdeII GATC 1 cut(s) 141
NlaIII CATG 2 cut(s) 126, 169
NmuCI GTSAC 1 cut(s) 44
PagI TCATGA 1 cut(s) 165
PceI AGGCCT 2 cut(s) 154, 187
PfeI GAWTC 2 cut(s) 58, 89
PleI GAGTC 2 cut(s) 41, 277
PpsI GAGTC 2 cut(s) 41, 277
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
SaqAI TTAA 2 cut(s) 69, 207
Sau3AI GATC 1 cut(s) 141
SchI GAGTC 2 cut(s) 41, 277
ScrFI CCNGG 1 cut(s) 189
SetI ASST 2 cut(s) 31, 240
SmlI CTYRAG 1 cut(s) 14
SmoI CTYRAG 1 cut(s) 14
Sse9I AATT 3 cut(s) 5, 35, 136
SseBI AGGCCT 2 cut(s) 154, 187
StuI AGGCCT 2 cut(s) 154, 187
StyD4I CCNGG 1 cut(s) 187
TaaI ACNGT 2 cut(s) 181, 293
TaqI TCGA 2 cut(s) 240, 281
TasI AATT 3 cut(s) 5, 35, 136
TfiI GAWTC 2 cut(s) 58, 89
Tru1I TTAA 2 cut(s) 69, 207
Tru9I TTAA 2 cut(s) 69, 207
TseFI GTSAC 1 cut(s) 44
Tsp45I GTSAC 1 cut(s) 44
TspDTI ATGAA 6 cut(s) 50, 111, 122, 154, 182, 265
TspGWI ACGGA 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.