Rh3DG314700

Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2- thiolation reaction by being thiocarboxylated (-COSH) at its C- terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0016072
Physical Location & Seq
Forward (+)
33843451 .. 33846578
3128 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG314700.1

Sequence Viewer

Length: 312 bp
ATGGACCTGAGGGAAATCAAATTTGCTTTATGCAGTGGAGGATTAGAGCTTCTTTGTAACTCTGTCAAGATTCATAATGTCAATGTAGAACTGCAAAAGGCAGCAGAAAAGTTAACCATGAAAGATTTACTGGCTTGGATTCGTACTAATTTGATCAAGGAGAGGCCTGAAATGTTTATGAAAGGAGATTCTGTGAGACCTGGTGTTCTAGCCCTTGTGAATGATTGTGATTGGGAGCTGACTGGTCAACTTGATACAACACTAGAGGAGAAGGATGTGGTTGTTTTCATTTCAACCTTGCACGGCGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04122 map04122
Pfam Domains
Protein Families
Urm1

Protein Analysis

103

Amino Acids

11.56

Weight (kDa)

5.1

Isoelectric Point (pI)

25.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Urm1 PF09138 12 - 103 2.9e-35 Urm1 (Ubiquitin related modifier)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016072)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G45695 AT3G61113
fragaria_vesca FvH4_1g27190
malus_domestica MD04G1046600.v1.1
prunus_persica Prupe.1G200200_v2.0.a1 Prupe.1G200200_v2.0.a1 Prupe.1G200200_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0487581
rosa_laevigata RLG00000022999
rosa_multiflora Rmu_sc0012412.1_g000002
rosa_roxburghii Rroxscaffold_6G00394690
rosa_rugosa Rorug03G0234100 Rorug03G0234200
rosa_samantha Rh3BG318600 Rh3DG314700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 306
AcsI RAATTY 1 cut(s) 20
AfaI GTAC 1 cut(s) 145
AgsI TTSAA 1 cut(s) 294
AjnI CCWGG 1 cut(s) 199
AluBI AGCT 2 cut(s) 49, 238
AluI AGCT 2 cut(s) 49, 238
Alw26I GTCTC 1 cut(s) 190
AoxI GGCC 1 cut(s) 164
ApeKI GCWGC 1 cut(s) 101
ApoI RAATTY 1 cut(s) 20
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
AxyI CCTNAGG 1 cut(s) 8
BbvI GCAGC 1 cut(s) 113
BciT130I CCWGG 1 cut(s) 201
BclI TGATCA 1 cut(s) 153
BcoDI GTCTC 1 cut(s) 190
BfaI CTAG 2 cut(s) 209, 263
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 201
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 201
BsaI GGTCTC 1 cut(s) 190
BsaXI ACNNNNNCTCC 2 cut(s) 177, 207
Bse1I ACTGG 2 cut(s) 135, 247
Bse21I CCTNAGG 1 cut(s) 8
BseBI CCWGG 1 cut(s) 201
BseGI GGATG 1 cut(s) 280
BseNI ACTGG 2 cut(s) 135, 247
BseRI GAGGAG 1 cut(s) 281
BseXI GCAGC 1 cut(s) 113
BshFI GGCC 1 cut(s) 166
BsmAI GTCTC 1 cut(s) 190
BsnI GGCC 1 cut(s) 166
Bso31I GGTCTC 1 cut(s) 190
Bsp143I GATC 1 cut(s) 153
BspACI CCGC 1 cut(s) 306
BspANI GGCC 1 cut(s) 166
BspTNI GGTCTC 1 cut(s) 190
BsrI ACTGG 2 cut(s) 135, 247
BssMI GATC 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 8
BstF5I GGATG 1 cut(s) 280
BstKTI GATC 1 cut(s) 156
BstMAI GTCTC 1 cut(s) 190
BstMBI GATC 1 cut(s) 153
BstNI CCWGG 1 cut(s) 201
BstSCI CCNGG 1 cut(s) 199
BstV1I GCAGC 1 cut(s) 113
Bsu36I CCTNAGG 1 cut(s) 8
BsuRI GGCC 1 cut(s) 166
BtsCI GGATG 1 cut(s) 280
BtsI GCAGTG 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 40
Cfr13I GGNCC 1 cut(s) 4
CsiI ACCWGGT 1 cut(s) 199
Csp6I GTAC 1 cut(s) 144
CviAII CATG 1 cut(s) 118
CviJI RGCY 5 cut(s) 49, 134, 166, 212, 238
CviKI_1 RGCY 5 cut(s) 49, 134, 166, 212, 238
CviQI GTAC 1 cut(s) 144
DdeI CTNAG 1 cut(s) 8
DpnI GATC 1 cut(s) 155
DpnII GATC 1 cut(s) 153
Eco147I AGGCCT 1 cut(s) 166
Eco31I GGTCTC 1 cut(s) 190
Eco47I GGWCC 1 cut(s) 4
Eco81I CCTNAGG 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 199
FaeI CATG 1 cut(s) 121
FaiI YATR 4 cut(s) 31, 75, 119, 179
FatI CATG 1 cut(s) 117
FbaI TGATCA 1 cut(s) 153
Fnu4HI GCNGC 1 cut(s) 102
FokI GGATG 1 cut(s) 287
Fsp4HI GCNGC 1 cut(s) 102
FspBI CTAG 2 cut(s) 209, 263
GluI GCNGC 1 cut(s) 102
HaeIII GGCC 1 cut(s) 166
Hin1II CATG 1 cut(s) 121
HincII GTYRAC 2 cut(s) 114, 248
HindII GTYRAC 2 cut(s) 114, 248
HinfI GANTC 3 cut(s) 70, 139, 188
HpaI GTTAAC 1 cut(s) 114
Hpy166II GTNNAC 2 cut(s) 114, 248
Hpy188III TCNNGA 1 cut(s) 67
Hpy8I GTNNAC 2 cut(s) 114, 248
HpyAV CCTTC 1 cut(s) 265
HpyCH4V TGCA 3 cut(s) 33, 94, 301
HpyF3I CTNAG 1 cut(s) 8
Hsp92II CATG 1 cut(s) 121
Ksp22I TGATCA 1 cut(s) 153
KspAI GTTAAC 1 cut(s) 114
Kzo9I GATC 1 cut(s) 153
LmnI GCTCC 1 cut(s) 235
LpnPI CCDG 6 cut(s) 20, 116, 180, 186, 213, 228
Lsp1109I GCAGC 1 cut(s) 113
MabI ACCWGGT 1 cut(s) 199
MaeI CTAG 2 cut(s) 209, 263
MaeIII GTNAC 1 cut(s) 56
MalI GATC 1 cut(s) 155
MboI GATC 1 cut(s) 153
MluCI AATT 2 cut(s) 20, 148
MnlI CCTC 4 cut(s) 3, 32, 156, 259
MseI TTAA 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 201
MvaI CCWGG 1 cut(s) 201
NdeII GATC 1 cut(s) 153
NlaIII CATG 1 cut(s) 121
PceI AGGCCT 1 cut(s) 166
PfeI GAWTC 3 cut(s) 70, 139, 188
PkrI GCNGC 1 cut(s) 103
Psp6I CCWGG 1 cut(s) 199
PspGI CCWGG 1 cut(s) 199
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SaqAI TTAA 1 cut(s) 113
SatI GCNGC 1 cut(s) 102
Sau3AI GATC 1 cut(s) 153
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 201
SetI ASST 5 cut(s) 9, 51, 202, 240, 299
SexAI ACCWGGT 1 cut(s) 199
SinI GGWCC 1 cut(s) 4
Sse9I AATT 2 cut(s) 20, 148
SseBI AGGCCT 1 cut(s) 166
SsiI CCGC 1 cut(s) 306
SspMI CTAG 2 cut(s) 209, 263
StuI AGGCCT 1 cut(s) 166
StyD4I CCNGG 1 cut(s) 199
TasI AATT 2 cut(s) 20, 148
TfiI GAWTC 3 cut(s) 70, 139, 188
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
TscAI CASTG 1 cut(s) 40
TseI GCWGC 1 cut(s) 101
TspDTI ATGAA 4 cut(s) 62, 134, 194, 277
TspRI CASTG 1 cut(s) 40
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 20
XspI CTAG 2 cut(s) 209, 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.