Rh3BG318600

Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2- thiolation reaction by being thiocarboxylated (-COSH) at its C- terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
32668931 .. 32676611
7681 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG318600.1

Sequence Viewer

Length: 465 bp
ATGGCGGTGAGATTGGCTCGGGTTGCAGGCGAAGAATATATAAGAGTAAAGGGGGTTAGGGTTTCTGTTATTCTTTCAATTGAAGAAAAAGACAAAGTAGAATACAAGAGCGATTTGCAGCACAGCAGCAGAGAAAACCTCAGAAACCTCTGCAGTCTTTCCAGTATGCAGCTGACCGTAGAATTCGGTGGAGGATTAGAGCTTCTTTGTAACTCTGTCAAGATTCATAATGTCAATGTAGAACTGCAAAAGGCAGCAGAAAAGTTAACCATGAAAGATTTACTGGCTTGGATTCGTACTAATTTGATCAAGGAGAGGCCTGAAATGTTTATGAAAGGAGATTCTGTGAGACCTGGTGTTCTAGCCCTTGTGAATGATTGTGATTGGGAGCTGACTGGTCAACTTGATACAACACTAGAGGAGAAGGATGTGGTTGTTTTCATTTCAACCTTGCACGGCGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

17.3

Weight (kDa)

5.67

Isoelectric Point (pI)

33.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Urm1 PF09138 58 - 154 3.5e-37 Urm1 (Ubiquitin related modifier)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016072)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 459
AcsI RAATTY 1 cut(s) 182
AfaI GTAC 1 cut(s) 298
AgsI TTSAA 3 cut(s) 78, 83, 447
AjnI CCWGG 1 cut(s) 352
AluBI AGCT 3 cut(s) 172, 202, 391
AluI AGCT 3 cut(s) 172, 202, 391
Alw26I GTCTC 1 cut(s) 343
Ama87I CYCGRG 1 cut(s) 18
AoxI GGCC 1 cut(s) 317
ApeKI GCWGC 4 cut(s) 118, 126, 169, 254
ApoI RAATTY 1 cut(s) 182
AsuHPI GGTGA 1 cut(s) 19
AvaI CYCGRG 1 cut(s) 18
BbvI GCAGC 4 cut(s) 130, 138, 181, 266
BciT130I CCWGG 1 cut(s) 354
BclI TGATCA 1 cut(s) 306
BcoDI GTCTC 1 cut(s) 343
BfaI CTAG 2 cut(s) 362, 416
BfmI CTRYAG 1 cut(s) 151
BisI GCNGC 4 cut(s) 119, 127, 170, 255
BlsI GCNGC 4 cut(s) 120, 128, 171, 256
Bme1390I CCNGG 1 cut(s) 354
BmeT110I CYCGRG 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 354
BplI GAGNNNNNCTC 3 cut(s) 33, 123, 155
BsaI GGTCTC 1 cut(s) 343
BsaXI ACNNNNNCTCC 2 cut(s) 330, 360
Bse1I ACTGG 3 cut(s) 162, 288, 400
BseBI CCWGG 1 cut(s) 354
BseGI GGATG 1 cut(s) 433
BseMII CTCAG 1 cut(s) 154
BseNI ACTGG 3 cut(s) 162, 288, 400
BseRI GAGGAG 1 cut(s) 434
BseXI GCAGC 4 cut(s) 130, 138, 181, 266
BshFI GGCC 1 cut(s) 319
BsiHKCI CYCGRG 1 cut(s) 18
BsmAI GTCTC 1 cut(s) 343
BsnI GGCC 1 cut(s) 319
Bso31I GGTCTC 1 cut(s) 343
BsoBI CYCGRG 1 cut(s) 18
Bsp143I GATC 1 cut(s) 306
BspACI CCGC 2 cut(s) 5, 459
BspANI GGCC 1 cut(s) 319
BspCNI CTCAG 1 cut(s) 153
BspMAI CTGCAG 1 cut(s) 155
BspTNI GGTCTC 1 cut(s) 343
BsrI ACTGG 3 cut(s) 162, 288, 400
BssMI GATC 1 cut(s) 306
Bst2UI CCWGG 1 cut(s) 354
Bst4CI ACNGT 1 cut(s) 178
BstC8I GCNNGC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 433
BstKTI GATC 1 cut(s) 309
BstMAI GTCTC 1 cut(s) 343
BstMBI GATC 1 cut(s) 306
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstNI CCWGG 1 cut(s) 354
BstSCI CCNGG 1 cut(s) 352
BstSFI CTRYAG 1 cut(s) 151
BstV1I GCAGC 4 cut(s) 130, 138, 181, 266
BsuRI GGCC 1 cut(s) 319
BtsCI GGATG 1 cut(s) 433
Cac8I GCNNGC 1 cut(s) 28
CsiI ACCWGGT 1 cut(s) 352
Csp6I GTAC 1 cut(s) 297
CviAII CATG 1 cut(s) 271
CviJI RGCY 7 cut(s) 17, 172, 202, 287, 319, 365, 391
CviKI_1 RGCY 7 cut(s) 17, 172, 202, 287, 319, 365, 391
CviQI GTAC 1 cut(s) 297
DdeI CTNAG 1 cut(s) 140
DpnI GATC 1 cut(s) 308
DpnII GATC 1 cut(s) 306
Eco147I AGGCCT 1 cut(s) 319
Eco31I GGTCTC 1 cut(s) 343
Eco88I CYCGRG 1 cut(s) 18
EcoRI GAATTC 1 cut(s) 182
EcoRII CCWGG 1 cut(s) 352
FaeI CATG 1 cut(s) 274
FaiI YATR 6 cut(s) 39, 41, 167, 228, 272, 332
FatI CATG 1 cut(s) 270
FbaI TGATCA 1 cut(s) 306
Fnu4HI GCNGC 4 cut(s) 119, 127, 170, 255
FokI GGATG 1 cut(s) 440
Fsp4HI GCNGC 4 cut(s) 119, 127, 170, 255
FspBI CTAG 2 cut(s) 362, 416
GluI GCNGC 4 cut(s) 119, 127, 170, 255
HaeIII GGCC 1 cut(s) 319
Hin1II CATG 1 cut(s) 274
HincII GTYRAC 2 cut(s) 267, 401
HindII GTYRAC 2 cut(s) 267, 401
HinfI GANTC 3 cut(s) 223, 292, 341
HpaI GTTAAC 1 cut(s) 267
HphI GGTGA 1 cut(s) 19
Hpy166II GTNNAC 2 cut(s) 267, 401
Hpy188I TCNGA 1 cut(s) 143
Hpy188III TCNNGA 1 cut(s) 220
Hpy8I GTNNAC 2 cut(s) 267, 401
HpyAV CCTTC 1 cut(s) 418
HpyCH4III ACNGT 1 cut(s) 178
HpyCH4V TGCA 6 cut(s) 26, 118, 153, 169, 247, 454
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 140
Hsp92II CATG 1 cut(s) 274
Ksp22I TGATCA 1 cut(s) 306
KspAI GTTAAC 1 cut(s) 267
Kzo9I GATC 1 cut(s) 306
LmnI GCTCC 1 cut(s) 388
LpnPI CCDG 7 cut(s) 12, 175, 269, 333, 339, 366, 381
Lsp1109I GCAGC 4 cut(s) 130, 138, 181, 266
MabI ACCWGGT 1 cut(s) 352
MaeI CTAG 2 cut(s) 362, 416
MaeIII GTNAC 1 cut(s) 209
MalI GATC 1 cut(s) 308
MboI GATC 1 cut(s) 306
MboII GAAGA 2 cut(s) 44, 95
MfeI CAATTG 1 cut(s) 78
MluCI AATT 3 cut(s) 78, 182, 301
MnlI CCTC 5 cut(s) 149, 158, 185, 309, 412
MseI TTAA 1 cut(s) 266
MspA1I CMGCKG 1 cut(s) 172
MspR9I CCNGG 1 cut(s) 354
MunI CAATTG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 354
MwoI GCNNNNNNNGC 1 cut(s) 23
NdeII GATC 1 cut(s) 306
NlaIII CATG 1 cut(s) 274
PceI AGGCCT 1 cut(s) 319
PfeI GAWTC 3 cut(s) 223, 292, 341
PkrI GCNGC 4 cut(s) 120, 128, 171, 256
Psp6I CCWGG 1 cut(s) 352
PspGI CCWGG 1 cut(s) 352
PstI CTGCAG 1 cut(s) 155
PvuII CAGCTG 1 cut(s) 172
RsaI GTAC 1 cut(s) 298
RsaNI GTAC 1 cut(s) 297
SaqAI TTAA 1 cut(s) 266
SatI GCNGC 4 cut(s) 119, 127, 170, 255
Sau3AI GATC 1 cut(s) 306
ScrFI CCNGG 1 cut(s) 354
SetI ASST 7 cut(s) 141, 150, 174, 204, 355, 393, 452
SexAI ACCWGGT 1 cut(s) 352
SfcI CTRYAG 1 cut(s) 151
Sse9I AATT 3 cut(s) 78, 182, 301
SseBI AGGCCT 1 cut(s) 319
SsiI CCGC 2 cut(s) 5, 459
SspMI CTAG 2 cut(s) 362, 416
StuI AGGCCT 1 cut(s) 319
StyD4I CCNGG 1 cut(s) 352
TaaI ACNGT 1 cut(s) 178
TasI AATT 3 cut(s) 78, 182, 301
TfiI GAWTC 3 cut(s) 223, 292, 341
Tru1I TTAA 1 cut(s) 266
Tru9I TTAA 1 cut(s) 266
TseI GCWGC 4 cut(s) 118, 126, 169, 254
TspDTI ATGAA 4 cut(s) 215, 287, 347, 430
XapI RAATTY 1 cut(s) 182
XspI CTAG 2 cut(s) 362, 416
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.