Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0017049

Physical Location & Seq

Genomic Coordinates Reverse (-)

515944 .. 516391

Gene Structure 448 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT3G02493.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 138 bp

ATGGAAAGCATCATGAGCTTGAAGAGAAAGGAGAAGAAATCCCAAAGTAGAAGACTCGGGAAATATCTGAAAGAACAAAAGGGGAGGATCTACATCATTAGAAGATGTGTGATGATGCTCCTTTGTTCGCATGATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DVL

Protein Analysis

45

Amino Acids

5.47

Weight (kDa)

10.3

Isoelectric Point (pI)

69.27

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DVL	PF08137	24 - 42	8.8e-11	DVL family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017049)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G02493 AT5G16023
fragaria_vesca	FvH4_6g45391
malus_domestica	MD09G1083800.v1.1
prunus_persica	Prupe.3G240100_v2.0.a1 Prupe.5G217900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0163211 RchiOBHm_Chr7g0184681
rosa_laevigata	RLG00000021383
rosa_multiflora	Rmu_co8508111.1_g000001
rosa_roxburghii	Rroxscaffold_2G00087460
rosa_samantha	Rh2BG580000 Rh2CG549800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	95
AgsI	TTSAA	1 cut(s)	22
AluBI	AGCT	1 cut(s)	18
AluI	AGCT	1 cut(s)	18
AlwI	GGATC	1 cut(s)	95
Ama87I	CYCGRG	1 cut(s)	56
AvaI	CYCGRG	1 cut(s)	56
BbsI	GAAGAC	1 cut(s)	58
BmeT110I	CYCGRG	1 cut(s)	56
BmsI	GCATC	2 cut(s)	18, 105
BpiI	GAAGAC	1 cut(s)	58
BsaBI	GATNNNNATC	1 cut(s)	92
Bse8I	GATNNNNATC	1 cut(s)	92
BseJI	GATNNNNATC	1 cut(s)	92
BsiHKCI	CYCGRG	1 cut(s)	56
BsoBI	CYCGRG	1 cut(s)	56
Bsp143I	GATC	1 cut(s)	87
BspHI	TCATGA	1 cut(s)	12
BspPI	GGATC	1 cut(s)	95
BssMI	GATC	1 cut(s)	87
Bst6I	CTCTTC	1 cut(s)	17
BstKTI	GATC	1 cut(s)	90
BstMBI	GATC	1 cut(s)	87
BstMWI	GCNNNNNNNGC	1 cut(s)	15
BstV2I	GAAGAC	1 cut(s)	58
BstX2I	RGATCY	1 cut(s)	87
BstYI	RGATCY	1 cut(s)	87
CciI	TCATGA	1 cut(s)	12
CviAII	CATG	2 cut(s)	13, 131
CviJI	RGCY	1 cut(s)	18
CviKI_1	RGCY	1 cut(s)	18
DpnI	GATC	1 cut(s)	89
DpnII	GATC	1 cut(s)	87
Eam1104I	CTCTTC	1 cut(s)	17
EarI	CTCTTC	1 cut(s)	17
Eco88I	CYCGRG	1 cut(s)	56
FaeI	CATG	2 cut(s)	16, 134
FaiI	YATR	2 cut(s)	14, 132
FatI	CATG	2 cut(s)	12, 130
Hin1II	CATG	2 cut(s)	16, 134
HinfI	GANTC	1 cut(s)	54
Hpy188I	TCNGA	1 cut(s)	69
Hpy188III	TCNNGA	2 cut(s)	13, 58
HpyF10VI	GCNNNNNNNGC	1 cut(s)	15
Hsp92II	CATG	2 cut(s)	16, 134
Kzo9I	GATC	1 cut(s)	87
LmnI	GCTCC	1 cut(s)	123
LweI	GCATC	2 cut(s)	18, 105
MalI	GATC	1 cut(s)	89
MboI	GATC	1 cut(s)	87
MboII	GAAGA	4 cut(s)	34, 46, 63, 114
MflI	RGATCY	1 cut(s)	87
MlyI	GAGTC	1 cut(s)	48
MnlI	CCTC	1 cut(s)	78
MseI	TTAA	1 cut(s)	136
MwoI	GCNNNNNNNGC	1 cut(s)	15
NdeII	GATC	1 cut(s)	87
NlaIII	CATG	2 cut(s)	16, 134
PagI	TCATGA	1 cut(s)	12
PleI	GAGTC	1 cut(s)	48
PpsI	GAGTC	1 cut(s)	48
PsuI	RGATCY	1 cut(s)	87
SaqAI	TTAA	1 cut(s)	136
Sau3AI	GATC	1 cut(s)	87
SchI	GAGTC	1 cut(s)	48
SetI	ASST	1 cut(s)	20
SfaNI	GCATC	2 cut(s)	18, 105
SgeI	CNNG	4 cut(s)	25, 31, 68, 70
Tru1I	TTAA	1 cut(s)	136
Tru9I	TTAA	1 cut(s)	136

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.