Prupe.5G217900_v2.0.a1

DVL family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Reverse (-)
17070927 .. 17072229
1303 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G217900.1

Sequence Viewer

Length: 147 bp
ATGAAGATGAAGAGTAGTGATGATACTGTTGAAGCCTCCAAGAGAAGGTTTTCATGCAAAGGGTCGTGCGGGTTTCTCAAAGAAGGAAGAGGAAGGCTCTACATATTCAGAAGATGTATTGTTATGCTTCTTTGCTGGCATGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.65

Weight (kDa)

9.62

Isoelectric Point (pI)

64.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017049)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AfiI CCNNNNNNNGG 1 cut(s) 45
AgsI TTSAA 1 cut(s) 32
Asp700I GAANNNNTTC 1 cut(s) 49
BplI GAGNNNNNCTC 2 cut(s) 81, 113
Bsc4I CCNNNNNNNGG 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 45
BspACI CCGC 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 28
Bst6I CTCTTC 2 cut(s) 5, 82
BstC8I GCNNGC 1 cut(s) 137
Cac8I GCNNGC 1 cut(s) 137
CviAII CATG 2 cut(s) 54, 140
CviJI RGCY 2 cut(s) 35, 97
CviKI_1 RGCY 2 cut(s) 35, 97
Eam1104I CTCTTC 2 cut(s) 5, 82
EarI CTCTTC 2 cut(s) 5, 82
FaeI CATG 2 cut(s) 57, 143
FaiI YATR 4 cut(s) 55, 104, 125, 141
FatI CATG 2 cut(s) 53, 139
FauI CCCGC 1 cut(s) 62
Hin1II CATG 2 cut(s) 57, 143
Hpy188I TCNGA 1 cut(s) 110
HpyAV CCTTC 3 cut(s) 39, 77, 87
HpyCH4III ACNGT 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 57
Hsp92II CATG 2 cut(s) 57, 143
LpnPI CCDG 1 cut(s) 121
MboII GAAGA 4 cut(s) 16, 22, 99, 123
MnlI CCTC 2 cut(s) 46, 83
MroXI GAANNNNTTC 1 cut(s) 49
NlaIII CATG 2 cut(s) 57, 143
PdmI GAANNNNTTC 1 cut(s) 49
SetI ASST 1 cut(s) 50
SgeI CNNG 4 cut(s) 52, 66, 78, 82
SsiI CCGC 1 cut(s) 69
TaaI ACNGT 1 cut(s) 28
TspDTI ATGAA 3 cut(s) 17, 23, 42
XmnI GAANNNNTTC 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.