RchiOBHm_Chr7g0184681

DVL family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
5154591 .. 5155066
476 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16477

Sequence Viewer

Length: 186 bp
ATGAAGATGGAAACCAATACAGGTGGTGAAGCCTCGAAGAAAAGGTCGTGTAAAGGACTCTGCGGTTTTCTTAAAGAAGGAAAAGGAAGGCTGTATATCTTGAGAAGATTGCTATTCACCTCCAGAAACTGTTTCCTTTCTCTTTCACGTTTCAATGCTTTACATCAGTGTAGTACTATCAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.92

Weight (kDa)

10.17

Isoelectric Point (pI)

45.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017049)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 63
AfaI GTAC 1 cut(s) 175
AgsI TTSAA 1 cut(s) 154
AlwNI CAGNNNCTG 1 cut(s) 129
ArsI GACNNNNNNTTYG 2 cut(s) 29, 61
AsuHPI GGTGA 2 cut(s) 38, 109
BmcAI AGTACT 1 cut(s) 175
BpmI CTGGAG 1 cut(s) 106
BpuEI CTTGAG 1 cut(s) 121
BspACI CCGC 1 cut(s) 63
Bst4CI ACNGT 1 cut(s) 131
BtsIMutI CAGTG 1 cut(s) 173
CaiI CAGNNNCTG 1 cut(s) 129
Csp6I GTAC 1 cut(s) 174
CspCI CAANNNNNGTGG 2 cut(s) 4, 39
CviJI RGCY 2 cut(s) 32, 91
CviKI_1 RGCY 2 cut(s) 32, 91
CviQI GTAC 1 cut(s) 174
FaiI YATR 1 cut(s) 96
GsuI CTGGAG 1 cut(s) 106
HinfI GANTC 1 cut(s) 57
HphI GGTGA 2 cut(s) 38, 109
Hpy188III TCNNGA 2 cut(s) 100, 123
HpyAV CCTTC 2 cut(s) 71, 81
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4IV ACGT 1 cut(s) 148
HpySE526I ACGT 1 cut(s) 148
LpnPI CCDG 2 cut(s) 6, 136
MaeII ACGT 1 cut(s) 148
MboII GAAGA 3 cut(s) 16, 49, 117
MlyI GAGTC 1 cut(s) 51
MnlI CCTC 2 cut(s) 43, 130
MseI TTAA 1 cut(s) 72
PleI GAGTC 1 cut(s) 51
PpsI GAGTC 1 cut(s) 51
PstNI CAGNNNCTG 1 cut(s) 129
RsaI GTAC 1 cut(s) 175
RsaNI GTAC 1 cut(s) 174
SaqAI TTAA 1 cut(s) 72
ScaI AGTACT 1 cut(s) 175
SchI GAGTC 1 cut(s) 51
SetI ASST 4 cut(s) 25, 47, 122, 151
SgeI CNNG 6 cut(s) 33, 46, 60, 112, 135, 159
SmlI CTYRAG 1 cut(s) 100
SmoI CTYRAG 1 cut(s) 100
SsiI CCGC 1 cut(s) 63
TaaI ACNGT 1 cut(s) 131
TaiI ACGT 1 cut(s) 151
TaqI TCGA 1 cut(s) 35
TatI WGTACW 1 cut(s) 173
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
TscAI CASTG 1 cut(s) 173
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 173
ZrmI AGTACT 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.