AT5G16023

DVL family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0017049
Physical Location & Seq
Reverse (-)
5232532 .. 5233036
505 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G16023.1

Sequence Viewer

Length: 156 bp
ATGGAAATGAAGAGGGTCATGATGAGCTCTGCAGAGAGATCAAAGGAGAAGAAGAGATCAATAAGTAGAAGATTGGGGAAGTATATGAAGGAACAAAAGGGAAGGATTTACATCATCAGAAGATGTATGGTCATGCTCCTTTGTTCGCATGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DVL

Protein Analysis

51

Amino Acids

6.21

Weight (kDa)

10.5

Isoelectric Point (pI)

93.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DVL PF08137 30 - 48 1.5e-09 DVL family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017049)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G02493 AT5G16023
fragaria_vesca FvH4_6g45391
malus_domestica MD09G1083800.v1.1
prunus_persica Prupe.3G240100_v2.0.a1 Prupe.5G217900_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0163211 RchiOBHm_Chr7g0184681
rosa_laevigata RLG00000021383
rosa_multiflora Rmu_co8508111.1_g000001
rosa_roxburghii Rroxscaffold_2G00087460
rosa_samantha Rh2BG580000 Rh2CG549800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
Alw21I GWGCWC 1 cut(s) 29
BanII GRGCYC 1 cut(s) 29
Bbv12I GWGCWC 1 cut(s) 29
BfmI CTRYAG 1 cut(s) 30
BsaBI GATNNNNATC 1 cut(s) 110
Bse8I GATNNNNATC 1 cut(s) 110
BseJI GATNNNNATC 1 cut(s) 110
BsiHKAI GWGCWC 1 cut(s) 29
Bsp1286I GDGCHC 1 cut(s) 29
Bsp143I GATC 2 cut(s) 38, 56
BspHI TCATGA 1 cut(s) 18
BspMAI CTGCAG 1 cut(s) 34
BssMI GATC 2 cut(s) 38, 56
Bst6I CTCTTC 2 cut(s) 5, 47
BstKTI GATC 2 cut(s) 41, 59
BstMBI GATC 2 cut(s) 38, 56
BstSFI CTRYAG 1 cut(s) 30
CciI TCATGA 1 cut(s) 18
CviAII CATG 3 cut(s) 19, 133, 149
CviJI RGCY 1 cut(s) 27
CviKI_1 RGCY 1 cut(s) 27
DpnI GATC 2 cut(s) 40, 58
DpnII GATC 2 cut(s) 38, 56
Eam1104I CTCTTC 2 cut(s) 5, 47
EarI CTCTTC 2 cut(s) 5, 47
Ecl136II GAGCTC 1 cut(s) 27
Eco24I GRGCYC 1 cut(s) 29
Eco53kI GAGCTC 1 cut(s) 27
EcoICRI GAGCTC 1 cut(s) 27
EcoT38I GRGCYC 1 cut(s) 29
FaeI CATG 3 cut(s) 22, 136, 152
FaiI YATR 6 cut(s) 20, 84, 86, 128, 134, 150
FatI CATG 3 cut(s) 18, 132, 148
FriOI GRGCYC 1 cut(s) 29
Hin1II CATG 3 cut(s) 22, 136, 152
Hpy188I TCNGA 1 cut(s) 119
Hpy188III TCNNGA 1 cut(s) 19
HpyAV CCTTC 2 cut(s) 82, 96
HpyCH4V TGCA 1 cut(s) 32
Hsp92II CATG 3 cut(s) 22, 136, 152
Kzo9I GATC 2 cut(s) 38, 56
LmnI GCTCC 1 cut(s) 141
MalI GATC 2 cut(s) 40, 58
MboI GATC 2 cut(s) 38, 56
MboII GAAGA 5 cut(s) 22, 61, 64, 81, 132
MhlI GDGCHC 1 cut(s) 29
MnlI CCTC 1 cut(s) 6
NdeII GATC 2 cut(s) 38, 56
NlaIII CATG 3 cut(s) 22, 136, 152
PagI TCATGA 1 cut(s) 18
Psp124BI GAGCTC 1 cut(s) 29
PstI CTGCAG 1 cut(s) 34
SacI GAGCTC 1 cut(s) 29
Sau3AI GATC 2 cut(s) 38, 56
SduI GDGCHC 1 cut(s) 29
SetI ASST 1 cut(s) 29
SfcI CTRYAG 1 cut(s) 30
SgeI CNNG 2 cut(s) 31, 145
SstI GAGCTC 1 cut(s) 29
TspDTI ATGAA 2 cut(s) 23, 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.