MD09G1083800.v1.1

DVL family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0017049
Physical Location & Seq
Reverse (-)
5929771 .. 5929923
153 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1083800.v1.1.491

Sequence Viewer

Length: 153 bp
ATGAAACTTAGCAGTTCAGGCATGGAAGCTAATCAGTCCAGCAAGAAAAATAGTGTTTCATGCAAAAGGTTTGGGGGGTATCTTAGACAACAGAAAGGAAGGCTCTACATCGTTAGGAGATGTGTAATCATGCTTCTCTGCTGGCACGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DVL

Protein Analysis

51

Amino Acids

5.79

Weight (kDa)

10.16

Isoelectric Point (pI)

68.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DVL PF08137 29 - 47 1.5e-10 DVL family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017049)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G02493 AT5G16023
fragaria_vesca FvH4_6g45391
malus_domestica MD09G1083800.v1.1
prunus_persica Prupe.3G240100_v2.0.a1 Prupe.5G217900_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0163211 RchiOBHm_Chr7g0184681
rosa_laevigata RLG00000021383
rosa_multiflora Rmu_co8508111.1_g000001
rosa_roxburghii Rroxscaffold_2G00087460
rosa_samantha Rh2BG580000 Rh2CG549800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
BarI GAAGNNNNNNTAC 2 cut(s) 117, 149
BstC8I GCNNGC 1 cut(s) 143
BstDEI CTNAG 2 cut(s) 8, 83
BstMWI GCNNNNNNNGC 1 cut(s) 18
Cac8I GCNNGC 1 cut(s) 143
CviAII CATG 3 cut(s) 22, 60, 130
CviJI RGCY 2 cut(s) 29, 103
CviKI_1 RGCY 2 cut(s) 29, 103
DdeI CTNAG 2 cut(s) 8, 83
FaeI CATG 3 cut(s) 25, 63, 133
FaiI YATR 3 cut(s) 23, 61, 131
FatI CATG 3 cut(s) 21, 59, 129
Hin1II CATG 3 cut(s) 25, 63, 133
HpyAV CCTTC 1 cut(s) 93
HpyCH4V TGCA 1 cut(s) 63
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpyF3I CTNAG 2 cut(s) 8, 83
Hsp92II CATG 3 cut(s) 25, 63, 133
LpnPI CCDG 3 cut(s) 3, 52, 127
MwoI GCNNNNNNNGC 1 cut(s) 18
NlaIII CATG 3 cut(s) 25, 63, 133
SetI ASST 2 cut(s) 31, 71
SgeI CNNG 6 cut(s) 30, 34, 51, 55, 72, 142
TspDTI ATGAA 2 cut(s) 17, 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.