Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0017049

Physical Location & Seq

Genomic Coordinates Reverse (-)

9512950 .. 9513905

Gene Structure 956 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00087460.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGGCAACTGAGTCGTCGTCTTCGCCGTCAAATGATAACAAGAGGTCGAAGGTTTCAAGCAGAAAGCTGAGAGGGTATCTTAGGCAACAGAAAGGGAGGCTCTACATCATCAGGAGATGTGTGGTTATGCTCCTCTGCTGGCATGACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DVL

Protein Analysis

49

Amino Acids

5.76

Weight (kDa)

10.6

Isoelectric Point (pI)

100.06

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DVL	PF08137	28 - 46	3.1e-11	DVL family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017049)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G02493 AT5G16023
fragaria_vesca	FvH4_6g45391
malus_domestica	MD09G1083800.v1.1
prunus_persica	Prupe.3G240100_v2.0.a1 Prupe.5G217900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0163211 RchiOBHm_Chr7g0184681
rosa_laevigata	RLG00000021383
rosa_multiflora	Rmu_co8508111.1_g000001
rosa_roxburghii	Rroxscaffold_2G00087460
rosa_samantha	Rh2BG580000 Rh2CG549800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	57
AluBI	AGCT	1 cut(s)	67
AluI	AGCT	1 cut(s)	67
BbsI	GAAGAC	1 cut(s)	12
BceAI	ACGGC	1 cut(s)	10
BcgI	CGANNNNNNTGC	1 cut(s)	28
BfaI	CTAG	1 cut(s)	148
BpiI	GAAGAC	1 cut(s)	12
BseMII	CTCAG	1 cut(s)	59
BseRI	GAGGAG	1 cut(s)	122
BspCNI	CTCAG	1 cut(s)	60
BstC8I	GCNNGC	1 cut(s)	140
BstDEI	CTNAG	3 cut(s)	9, 68, 80
BstV2I	GAAGAC	1 cut(s)	12
Cac8I	GCNNGC	1 cut(s)	140
CviAII	CATG	1 cut(s)	143
CviJI	RGCY	2 cut(s)	67, 100
CviKI_1	RGCY	2 cut(s)	67, 100
DdeI	CTNAG	3 cut(s)	9, 68, 80
FaeI	CATG	1 cut(s)	146
FaiI	YATR	2 cut(s)	128, 144
FatI	CATG	1 cut(s)	142
FspBI	CTAG	1 cut(s)	148
Hin1II	CATG	1 cut(s)	146
HinfI	GANTC	1 cut(s)	11
Hpy188III	TCNNGA	1 cut(s)	112
Hpy99I	CGWCG	1 cut(s)	19
HpyAV	CCTTC	1 cut(s)	43
HpyF3I	CTNAG	3 cut(s)	9, 68, 80
Hsp92II	CATG	1 cut(s)	146
LmnI	GCTCC	1 cut(s)	135
LpnPI	CCDG	2 cut(s)	97, 124
MaeI	CTAG	1 cut(s)	148
MboII	GAAGA	1 cut(s)	12
MlyI	GAGTC	1 cut(s)	20
MnlI	CCTC	4 cut(s)	36, 65, 90, 143
NlaIII	CATG	1 cut(s)	146
PcsI	WCGNNNNNNNCGW	1 cut(s)	23
PleI	GAGTC	1 cut(s)	19
PpsI	GAGTC	1 cut(s)	19
SchI	GAGTC	1 cut(s)	20
SetI	ASST	3 cut(s)	47, 54, 69
SgeI	CNNG	3 cut(s)	52, 69, 124
SspMI	CTAG	1 cut(s)	148
TaqI	TCGA	1 cut(s)	47
XspI	CTAG	1 cut(s)	148

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.