AT4G28088

low temperature and salt responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0007615
Physical Location & Seq
Reverse (-)
13961134 .. 13961611
478 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G28088.1

Sequence Viewer

Length: 234 bp
ATGGCGAATGGGTGCGAGATTTGCTGTGAAATAATGATCGCCATACTCATCCCTCCTCTAGGGGTTTGTCTGAGGCATGGCTGTTGCACTACGGAATTCATGATATGTCTGATCCTAACGCTCTTGGGATACGTACCGGGGATCATCTACGCACTCTATGCAATCGTGTACGTGGATCGTGATCAATTTTTCGATGAGTACCGTCGTCCACTTTTCTATGCCCAGTCACCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pmp3

Protein Analysis

77

Amino Acids

8.76

Weight (kDa)

4.7

Isoelectric Point (pI)

65.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 8 - 56 1.7e-18 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 106, 149, 183
AcsI RAATTY 1 cut(s) 95
AfaI GTAC 3 cut(s) 135, 170, 200
AfiI CCNNNNNNNGG 1 cut(s) 59
AlwI GGATC 3 cut(s) 106, 149, 183
ApoI RAATTY 1 cut(s) 95
AsuC2I CCSGG 1 cut(s) 138
AsuHPI GGTGA 1 cut(s) 219
BciVI GTATCC 1 cut(s) 122
BclI TGATCA 1 cut(s) 181
BcnI CCSGG 1 cut(s) 138
BfaI CTAG 1 cut(s) 59
BfuI GTATCC 1 cut(s) 122
Bme1390I CCNGG 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 138
BmrI ACTGGG 1 cut(s) 217
BmuI ACTGGG 1 cut(s) 217
BpuMI CCSGG 1 cut(s) 138
BsaAI YACGTR 2 cut(s) 133, 172
BsaBI GATNNNNATC 1 cut(s) 180
BsaJI CCNNGG 1 cut(s) 137
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse1I ACTGG 1 cut(s) 223
Bse8I GATNNNNATC 1 cut(s) 180
BseDI CCNNGG 1 cut(s) 137
BseGI GGATG 1 cut(s) 48
BseJI GATNNNNATC 1 cut(s) 180
BseLI CCNNNNNNNGG 1 cut(s) 59
BseMII CTCAG 1 cut(s) 62
BseNI ACTGG 1 cut(s) 223
BseRI GAGGAG 1 cut(s) 45
BsiSI CCGG 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 59
Bsp143I GATC 5 cut(s) 36, 111, 141, 175, 181
BspCNI CTCAG 1 cut(s) 63
BspHI TCATGA 1 cut(s) 99
BspPI GGATC 3 cut(s) 106, 149, 183
BsrI ACTGG 1 cut(s) 223
BssECI CCNNGG 1 cut(s) 137
BssMI GATC 5 cut(s) 36, 111, 141, 175, 181
Bst4CI ACNGT 2 cut(s) 203, 231
BstAPI GCANNNNNTGC 1 cut(s) 158
BstBAI YACGTR 2 cut(s) 133, 172
BstDEI CTNAG 1 cut(s) 71
BstENI CCTNNNNNAGG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 48
BstKTI GATC 5 cut(s) 39, 114, 144, 178, 184
BstMBI GATC 5 cut(s) 36, 111, 141, 175, 181
BstMWI GCNNNNNNNGC 2 cut(s) 21, 158
BstSCI CCNGG 1 cut(s) 136
BstSNI TACGTA 1 cut(s) 133
BsuI GTATCC 1 cut(s) 122
BtsCI GGATG 1 cut(s) 48
CciI TCATGA 1 cut(s) 99
Csp6I GTAC 3 cut(s) 134, 169, 199
CviAII CATG 2 cut(s) 77, 100
CviJI RGCY 1 cut(s) 81
CviKI_1 RGCY 1 cut(s) 81
CviQI GTAC 3 cut(s) 134, 169, 199
DdeI CTNAG 1 cut(s) 71
DpnI GATC 5 cut(s) 38, 113, 143, 177, 183
DpnII GATC 5 cut(s) 36, 111, 141, 175, 181
Eco105I TACGTA 1 cut(s) 133
EcoNI CCTNNNNNAGG 1 cut(s) 57
EcoRI GAATTC 1 cut(s) 95
FaeI CATG 2 cut(s) 80, 103
FaiI YATR 6 cut(s) 44, 78, 101, 106, 159, 219
FatI CATG 2 cut(s) 76, 99
FbaI TGATCA 1 cut(s) 181
FokI GGATG 1 cut(s) 35
FspBI CTAG 1 cut(s) 59
HapII CCGG 1 cut(s) 137
Hin1II CATG 2 cut(s) 80, 103
HpaII CCGG 1 cut(s) 137
HphI GGTGA 1 cut(s) 219
Hpy166II GTNNAC 2 cut(s) 169, 209
Hpy188I TCNGA 2 cut(s) 72, 111
Hpy188III TCNNGA 2 cut(s) 100, 179
Hpy8I GTNNAC 2 cut(s) 169, 209
Hpy99I CGWCG 1 cut(s) 207
HpyCH4III ACNGT 2 cut(s) 203, 231
HpyCH4IV ACGT 2 cut(s) 132, 171
HpyCH4V TGCA 2 cut(s) 87, 161
HpyF10VI GCNNNNNNNGC 2 cut(s) 21, 158
HpyF3I CTNAG 1 cut(s) 71
HpySE526I ACGT 2 cut(s) 132, 171
Hsp92II CATG 2 cut(s) 80, 103
Ksp22I TGATCA 1 cut(s) 181
Kzo9I GATC 5 cut(s) 36, 111, 141, 175, 181
LpnPI CCDG 1 cut(s) 150
MaeI CTAG 1 cut(s) 59
MaeII ACGT 2 cut(s) 132, 171
MaeIII GTNAC 1 cut(s) 225
MalI GATC 5 cut(s) 38, 113, 143, 177, 183
MboI GATC 5 cut(s) 36, 111, 141, 175, 181
MluCI AATT 2 cut(s) 95, 185
MnlI CCTC 3 cut(s) 63, 66, 66
MspI CCGG 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 138
MwoI GCNNNNNNNGC 2 cut(s) 21, 158
NciI CCSGG 1 cut(s) 138
NdeII GATC 5 cut(s) 36, 111, 141, 175, 181
NlaIII CATG 2 cut(s) 80, 103
NmuCI GTSAC 1 cut(s) 225
PagI TCATGA 1 cut(s) 99
Ppu21I YACGTR 2 cut(s) 133, 172
RsaI GTAC 3 cut(s) 135, 170, 200
RsaNI GTAC 3 cut(s) 134, 169, 199
Sau3AI GATC 5 cut(s) 36, 111, 141, 175, 181
ScrFI CCNGG 1 cut(s) 138
SetI ASST 2 cut(s) 135, 174
SnaBI TACGTA 1 cut(s) 133
Sse9I AATT 2 cut(s) 95, 185
SspMI CTAG 1 cut(s) 59
StyD4I CCNGG 1 cut(s) 136
TaaI ACNGT 2 cut(s) 203, 231
TaiI ACGT 2 cut(s) 135, 174
TaqI TCGA 1 cut(s) 192
TasI AATT 2 cut(s) 95, 185
TseFI GTSAC 1 cut(s) 225
Tsp45I GTSAC 1 cut(s) 225
TspDTI ATGAA 1 cut(s) 88
TspGWI ACGGA 1 cut(s) 107
XagI CCTNNNNNAGG 1 cut(s) 57
XapI RAATTY 1 cut(s) 95
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.