AT4G30650

Hydrophobic protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
14954204 .. 14955114
911 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G30650.1

Sequence Viewer

Length: 222 bp
ATGGCGAGCAACATGGAAGTTTTCTGCGAGATCTTAATCGCGATCCTTCTTCCACCTCTTGGAGTTTGTCTCAAACGTGGCTGTTGCACTGTAGAGTTCTTGATTTGCTTGGTGCTGACAATCTTAGGATACATCCCAGGGATAATTTATGCACTATACGTGATCGTGTTTCAAAACCGTGAAGGCTCTACCGAACTTGGAGCTCCACTTAACTCAGCTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

7.91

Weight (kDa)

4.65

Isoelectric Point (pI)

42.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 8 - 56 1.8e-20 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 59
AccII CGCG 1 cut(s) 41
AclWI GGATC 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 59
AgsI TTSAA 1 cut(s) 173
AjnI CCWGG 1 cut(s) 136
AluBI AGCT 2 cut(s) 203, 218
AluI AGCT 2 cut(s) 203, 218
Alw21I GWGCWC 1 cut(s) 205
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 1 cut(s) 37
BanII GRGCYC 1 cut(s) 205
Bbv12I GWGCWC 1 cut(s) 205
BciT130I CCWGG 1 cut(s) 138
BciVI GTATCC 1 cut(s) 122
BcoDI GTCTC 1 cut(s) 74
BfmI CTRYAG 1 cut(s) 90
BfuI GTATCC 1 cut(s) 122
BglII AGATCT 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 138
BplI GAGNNNNNCTC 2 cut(s) 54, 86
BsaAI YACGTR 1 cut(s) 160
BsaBI GATNNNNATC 1 cut(s) 35
BsaJI CCNNGG 2 cut(s) 136, 137
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse8I GATNNNNATC 1 cut(s) 35
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 2 cut(s) 136, 137
BseGI GGATG 1 cut(s) 132
BseJI GATNNNNATC 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 59
Bsh1236I CGCG 1 cut(s) 41
BsiHKAI GWGCWC 1 cut(s) 205
BslI CCNNNNNNNGG 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 74
Bsp1286I GDGCHC 1 cut(s) 205
Bsp143I GATC 3 cut(s) 30, 42, 162
Bsp68I TCGCGA 1 cut(s) 41
BspFNI CGCG 1 cut(s) 41
BspPI GGATC 1 cut(s) 37
BssECI CCNNGG 2 cut(s) 136, 137
BssMI GATC 3 cut(s) 30, 42, 162
Bst2UI CCWGG 1 cut(s) 138
Bst4CI ACNGT 2 cut(s) 91, 179
BstBAI YACGTR 1 cut(s) 160
BstC8I GCNNGC 1 cut(s) 7
BstDEI CTNAG 2 cut(s) 124, 214
BstF5I GGATG 1 cut(s) 132
BstFNI CGCG 1 cut(s) 41
BstKTI GATC 3 cut(s) 33, 45, 165
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 3 cut(s) 30, 42, 162
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstSFI CTRYAG 1 cut(s) 90
BstUI CGCG 1 cut(s) 41
BstX2I RGATCY 1 cut(s) 30
BstYI RGATCY 1 cut(s) 30
BsuI GTATCC 1 cut(s) 122
BtsCI GGATG 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 87
BtuMI TCGCGA 1 cut(s) 41
Cac8I GCNNGC 1 cut(s) 7
CviAII CATG 1 cut(s) 13
CviJI RGCY 4 cut(s) 81, 186, 203, 218
CviKI_1 RGCY 4 cut(s) 81, 186, 203, 218
DdeI CTNAG 2 cut(s) 124, 214
DpnI GATC 3 cut(s) 32, 44, 164
DpnII GATC 3 cut(s) 30, 42, 162
Ecl136II GAGCTC 1 cut(s) 203
Eco24I GRGCYC 1 cut(s) 205
Eco53kI GAGCTC 1 cut(s) 203
EcoICRI GAGCTC 1 cut(s) 203
EcoRII CCWGG 1 cut(s) 136
EcoT38I GRGCYC 1 cut(s) 205
FaeI CATG 1 cut(s) 16
FaiI YATR 3 cut(s) 14, 150, 157
FatI CATG 1 cut(s) 12
FokI GGATG 1 cut(s) 119
FriOI GRGCYC 1 cut(s) 205
Hin1II CATG 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 40, 100
HpyAV CCTTC 2 cut(s) 56, 176
HpyCH4III ACNGT 2 cut(s) 91, 179
HpyCH4IV ACGT 2 cut(s) 76, 159
HpyCH4V TGCA 2 cut(s) 87, 152
HpyF3I CTNAG 2 cut(s) 124, 214
HpySE526I ACGT 2 cut(s) 76, 159
Hsp92II CATG 1 cut(s) 16
Kzo9I GATC 3 cut(s) 30, 42, 162
LmnI GCTCC 2 cut(s) 200, 208
LpnPI CCDG 2 cut(s) 123, 150
MaeII ACGT 2 cut(s) 76, 159
MalI GATC 3 cut(s) 32, 44, 164
MboI GATC 3 cut(s) 30, 42, 162
MboII GAAGA 1 cut(s) 41
MflI RGATCY 1 cut(s) 30
MhlI GDGCHC 1 cut(s) 205
MluCI AATT 1 cut(s) 144
MnlI CCTC 1 cut(s) 66
MseI TTAA 2 cut(s) 35, 210
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
MvnI CGCG 1 cut(s) 41
NdeII GATC 3 cut(s) 30, 42, 162
NlaIII CATG 1 cut(s) 16
NruI TCGCGA 1 cut(s) 41
PasI CCCWGGG 1 cut(s) 137
PflMI CCANNNNNTGG 1 cut(s) 59
Ppu21I YACGTR 1 cut(s) 160
Psp124BI GAGCTC 1 cut(s) 205
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
PsuI RGATCY 1 cut(s) 30
RruI TCGCGA 1 cut(s) 41
SacI GAGCTC 1 cut(s) 205
SaqAI TTAA 2 cut(s) 35, 210
Sau3AI GATC 3 cut(s) 30, 42, 162
ScrFI CCNGG 1 cut(s) 138
SduI GDGCHC 1 cut(s) 205
SetI ASST 5 cut(s) 58, 79, 162, 205, 220
SfcI CTRYAG 1 cut(s) 90
Sse9I AATT 1 cut(s) 144
SstI GAGCTC 1 cut(s) 205
StyD4I CCNGG 1 cut(s) 136
TaaI ACNGT 2 cut(s) 91, 179
TaiI ACGT 2 cut(s) 79, 162
TasI AATT 1 cut(s) 144
Tru1I TTAA 2 cut(s) 35, 210
Tru9I TTAA 2 cut(s) 35, 210
TscAI CASTG 1 cut(s) 94
TspRI CASTG 1 cut(s) 94
Van91I CCANNNNNTGG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.