AT5G02580

Plant protein 1589 of unknown function (A_thal_3526)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0009837
Physical Location & Seq
Forward (+)
579744 .. 580792
1049 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G02580.2

Sequence Viewer

Length: 276 bp
ATGGGTGATCATAATAGCTCGCAAGCTTCTTACATCCATTTGGTGCATCATTTGATAGAAGAATGTATAGTATTCAACATGGGCAAAGAAGAGTGTATGGATGCTCTGTTCAAGCATGCTAATATTAAGCCTATCATCACTTCCACAGTGTGGAAAGAGCTAGCGAAAGAGAACAAAGAGTTCTTCGAGGCATACGAGAGAAGACGAGAAGAAATACCGACCGAGAAAGAGACAGCTCGAAGAATCCGTGATTTGCTTTCACGAACTACAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
A_thal_3526

Protein Analysis

91

Amino Acids

10.78

Weight (kDa)

6.2

Isoelectric Point (pI)

73.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 15 - 49 6.4e-13 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 150
AdeI CACNNNGTG 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 150
AgsI TTSAA 2 cut(s) 76, 112
AloI GAACNNNNNNTCC 2 cut(s) 92, 124
AluBI AGCT 4 cut(s) 18, 26, 160, 236
AluI AGCT 4 cut(s) 18, 26, 160, 236
Alw26I GTCTC 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 17
AsuNHI GCTAGC 1 cut(s) 160
BbsI GAAGAC 1 cut(s) 208
BclI TGATCA 1 cut(s) 7
BcoDI GTCTC 1 cut(s) 224
BfaI CTAG 1 cut(s) 161
BmsI GCATC 2 cut(s) 55, 91
BmtI GCTAGC 1 cut(s) 164
BpiI GAAGAC 1 cut(s) 208
Bsc4I CCNNNNNNNGG 1 cut(s) 150
BseGI GGATG 2 cut(s) 33, 106
BseLI CCNNNNNNNGG 1 cut(s) 150
Bsh1285I CGRYCG 1 cut(s) 222
BsiEI CGRYCG 1 cut(s) 222
BslI CCNNNNNNNGG 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 224
Bsp143I GATC 1 cut(s) 7
BspOI GCTAGC 1 cut(s) 164
BssMI GATC 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 148
Bst6I CTCTTC 1 cut(s) 84
BstC8I GCNNGC 4 cut(s) 20, 24, 117, 162
BstF5I GGATG 2 cut(s) 33, 106
BstKTI GATC 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 224
BstMBI GATC 1 cut(s) 7
BstMCI CGRYCG 1 cut(s) 222
BstNSI RCATGY 1 cut(s) 119
BstV2I GAAGAC 1 cut(s) 208
BtsCI GGATG 2 cut(s) 33, 106
BtsIMutI CAGTG 1 cut(s) 153
Cac8I GCNNGC 4 cut(s) 20, 24, 117, 162
CviAII CATG 2 cut(s) 79, 116
CviJI RGCY 5 cut(s) 18, 26, 130, 160, 236
CviKI_1 RGCY 5 cut(s) 18, 26, 130, 160, 236
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
DraIII CACNNNGTG 1 cut(s) 150
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
FaeI CATG 2 cut(s) 82, 119
FaiI YATR 6 cut(s) 12, 68, 80, 98, 117, 193
FatI CATG 2 cut(s) 78, 115
FbaI TGATCA 1 cut(s) 7
FokI GGATG 2 cut(s) 20, 113
FspBI CTAG 1 cut(s) 161
Hin1II CATG 2 cut(s) 82, 119
HindIII AAGCTT 1 cut(s) 24
HinfI GANTC 1 cut(s) 243
HphI GGTGA 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 261
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 46
Hsp92II CATG 2 cut(s) 82, 119
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 1 cut(s) 7
LweI GCATC 2 cut(s) 55, 91
MaeI CTAG 1 cut(s) 161
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 6 cut(s) 71, 101, 175, 213, 221, 252
MnlI CCTC 1 cut(s) 181
MseI TTAA 1 cut(s) 126
NdeII GATC 1 cut(s) 7
NheI GCTAGC 1 cut(s) 160
NlaIII CATG 2 cut(s) 82, 119
NspI RCATGY 1 cut(s) 119
PaeI GCATGC 1 cut(s) 119
PcsI WCGNNNNNNNCGW 2 cut(s) 192, 244
PfeI GAWTC 1 cut(s) 243
PflMI CCANNNNNTGG 1 cut(s) 150
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 1 cut(s) 7
SetI ASST 4 cut(s) 20, 28, 162, 238
SfaNI GCATC 2 cut(s) 55, 91
SphI GCATGC 1 cut(s) 119
SspI AATATT 1 cut(s) 124
SspMI CTAG 1 cut(s) 161
TaaI ACNGT 1 cut(s) 148
TaqI TCGA 2 cut(s) 186, 238
TaqII GACCGA 1 cut(s) 236
TfiI GAWTC 1 cut(s) 243
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 1 cut(s) 153
TspGWI ACGGA 1 cut(s) 236
TspRI CASTG 1 cut(s) 153
Van91I CCANNNNNTGG 1 cut(s) 150
XceI RCATGY 1 cut(s) 119
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.