Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3D

Orthogroup ID

OG0009837

Physical Location & Seq

Genomic Coordinates Forward (+)

13776057 .. 13777620

Gene Structure 1564 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3DG159300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

ATGAGCAGAGAAGAGTGCATGGAAGCCCTCTCCAAGCATGCAAATATAAAACCCATTATTACCTCCACAGTTTGGAAGGAGCTGGAGAAGGAGAACAAGGAGTTCTTTGAGGCCTACACAAACAGCAGAGAAGCTGTGAGAGAATCCAAAATGGAGAGAAAGCAAAGAATCCAGAAGATGCTTTCGGGTCATCTTTCTCAAACAGACACAGAGGACAGCAGCTGCACCAATACTACCGAATCCGACGACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

A_thal_3526

Protein Analysis

83

Amino Acids

9.67

Weight (kDa)

5.22

Isoelectric Point (pI)

68.82

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
A_thal_3526	PF09713	1 - 40	1.4e-19	Plant protein 1589 of unknown function (A_thal_3526)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009837)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G02580 AT5G02580
fragaria_vesca	FvH4_6g14600
malus_domestica	MD04G1119000.v1.1 MD12G1136300.v1.1
prunus_persica	Prupe.6G248700_v2.0.a1 Prupe.6G248700_v2.0.a1
pyrus_communis	pycom04g10850 pycom12g13040
rosa_chinensis	RchiOBHm_Chr3g0467681
rosa_laevigata	RLG00000024481
rosa_multiflora	Rmu_sc0011632.1_g000004 Rmu_sc0040187.1_g000001
rosa_roxburghii	Rroxscaffold_6G00413520
rosa_rugosa	Rorug03G0089000 Rorug03G0089100
rosa_samantha	Rh3AG137400 Rh3BG158800 Rh3CG158700 Rh3DG159300
rosa_wichuraiana	Rw3G013010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	72
AfiI	CCNNNNNNNGG	1 cut(s)	72
AluBI	AGCT	3 cut(s)	82, 134, 222
AluI	AGCT	3 cut(s)	82, 134, 222
AlwNI	CAGNNNCTG	1 cut(s)	222
AoxI	GGCC	1 cut(s)	111
ApeKI	GCWGC	2 cut(s)	219, 222
BbvI	GCAGC	2 cut(s)	209, 231
BfaI	CTAG	1 cut(s)	250
BisI	GCNGC	2 cut(s)	220, 223
BlsI	GCNGC	2 cut(s)	221, 224
BmsI	GCATC	1 cut(s)	168
BpmI	CTGGAG	1 cut(s)	104
Bsc4I	CCNNNNNNNGG	1 cut(s)	72
BseLI	CCNNNNNNNGG	1 cut(s)	72
BseXI	GCAGC	2 cut(s)	209, 231
BsgI	GTGCAG	1 cut(s)	208
BshFI	GGCC	1 cut(s)	113
BslI	CCNNNNNNNGG	1 cut(s)	72
BsnI	GGCC	1 cut(s)	113
BspANI	GGCC	1 cut(s)	113
Bst4CI	ACNGT	1 cut(s)	70
Bst6I	CTCTTC	1 cut(s)	6
BstC8I	GCNNGC	1 cut(s)	39
BstNSI	RCATGY	1 cut(s)	41
BstV1I	GCAGC	2 cut(s)	209, 231
BsuRI	GGCC	1 cut(s)	113
Cac8I	GCNNGC	1 cut(s)	39
CaiI	CAGNNNCTG	1 cut(s)	222
CviAII	CATG	2 cut(s)	19, 38
CviJI	RGCY	5 cut(s)	26, 82, 113, 134, 222
CviKI_1	RGCY	5 cut(s)	26, 82, 113, 134, 222
Eam1104I	CTCTTC	1 cut(s)	6
EarI	CTCTTC	1 cut(s)	6
Eco147I	AGGCCT	1 cut(s)	113
FaeI	CATG	2 cut(s)	22, 41
FaiI	YATR	3 cut(s)	20, 39, 47
FalI	AAGNNNNNCTT	2 cut(s)	89, 121
FatI	CATG	2 cut(s)	18, 37
Fnu4HI	GCNGC	2 cut(s)	220, 223
Fsp4HI	GCNGC	2 cut(s)	220, 223
FspBI	CTAG	1 cut(s)	250
GluI	GCNGC	2 cut(s)	220, 223
GsuI	CTGGAG	1 cut(s)	104
HaeIII	GGCC	1 cut(s)	113
Hin1II	CATG	2 cut(s)	22, 41
HinfI	GANTC	3 cut(s)	143, 168, 239
Hpy188I	TCNGA	1 cut(s)	244
Hpy188III	TCNNGA	1 cut(s)	172
Hpy99I	CGWCG	1 cut(s)	248
HpyAV	CCTTC	2 cut(s)	70, 82
HpyCH4III	ACNGT	1 cut(s)	70
HpyCH4V	TGCA	3 cut(s)	18, 41, 225
Hsp92II	CATG	2 cut(s)	22, 41
LmnI	GCTCC	1 cut(s)	79
LpnPI	CCDG	2 cut(s)	68, 185
Lsp1109I	GCAGC	2 cut(s)	209, 231
LweI	GCATC	1 cut(s)	168
MaeI	CTAG	1 cut(s)	250
MboII	GAAGA	2 cut(s)	23, 187
MnlI	CCTC	4 cut(s)	38, 73, 103, 205
MspA1I	CMGCKG	1 cut(s)	222
NlaIII	CATG	2 cut(s)	22, 41
NspI	RCATGY	1 cut(s)	41
PaeI	GCATGC	1 cut(s)	41
PceI	AGGCCT	1 cut(s)	113
PfeI	GAWTC	3 cut(s)	143, 168, 239
PflMI	CCANNNNNTGG	1 cut(s)	72
PkrI	GCNGC	2 cut(s)	221, 224
PstNI	CAGNNNCTG	1 cut(s)	222
PvuII	CAGCTG	1 cut(s)	222
SatI	GCNGC	2 cut(s)	220, 223
SetI	ASST	4 cut(s)	65, 84, 136, 224
SfaNI	GCATC	1 cut(s)	168
SgeI	CNNG	7 cut(s)	31, 46, 50, 95, 109, 184, 198
SphI	GCATGC	1 cut(s)	41
SseBI	AGGCCT	1 cut(s)	113
SspMI	CTAG	1 cut(s)	250
StuI	AGGCCT	1 cut(s)	113
TaaI	ACNGT	1 cut(s)	70
TfiI	GAWTC	3 cut(s)	143, 168, 239
TseI	GCWGC	2 cut(s)	219, 222
Van91I	CCANNNNNTGG	1 cut(s)	72
XceI	RCATGY	1 cut(s)	41
XspI	CTAG	1 cut(s)	250

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.