Prupe.6G248700_v2.0.a1

Plant protein 1589 of unknown function (A_thal_3526)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
24446128 .. 24447511
1384 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G248700.2

Sequence Viewer

Length: 303 bp
ATGGTGGTGACATGCATGATTATAATGATTAATCAGGTGCACCATTTAATCGAGGAGTGCATCATATTCAACATGAGCAAAGAAGAGTGCATGGAAGCCCTCTCTAAGCATGCAAACATCAAACCCGTCATTACCTCAACAGTGTGGAAGGAGCTGGAGAAGGAGAACAAGGAGTTCTTTGAGGCGTACACAAAGAACAGGGAAACTAGAGCCTCTGAGATGGAGATCACAAAGCAAAGGATCGAGAAGATGCTTTTCGATCTTTCGCAAAAAGACAGCTCCGACGACGATGATCAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.85

Weight (kDa)

5.06

Isoelectric Point (pI)

65.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
AclWI GGATC 1 cut(s) 248
AfaI GTAC 1 cut(s) 188
AgsI TTSAA 1 cut(s) 70
AluBI AGCT 2 cut(s) 154, 279
AluI AGCT 2 cut(s) 154, 279
Alw21I GWGCWC 1 cut(s) 42
Alw44I GTGCAC 1 cut(s) 38
AlwI GGATC 1 cut(s) 248
ApaLI GTGCAC 1 cut(s) 38
AseI ATTAAT 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 19
BaeGI GKGCMC 1 cut(s) 42
Bbv12I GWGCWC 1 cut(s) 42
BccI CCATC 1 cut(s) 214
BclI TGATCA 1 cut(s) 292
BfaI CTAG 1 cut(s) 207
BmsI GCATC 2 cut(s) 69, 240
BpmI CTGGAG 1 cut(s) 176
BsaBI GATNNNNATC 1 cut(s) 224
Bse8I GATNNNNATC 1 cut(s) 224
BseJI GATNNNNATC 1 cut(s) 224
BseMII CTCAG 1 cut(s) 207
BseRI GAGGAG 1 cut(s) 68
BseSI GKGCMC 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 42
Bsp143I GATC 4 cut(s) 225, 240, 259, 292
BspCNI CTCAG 1 cut(s) 208
BspPI GGATC 1 cut(s) 248
BssMI GATC 4 cut(s) 225, 240, 259, 292
Bst4CI ACNGT 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 2 cut(s) 105, 216
BstKTI GATC 4 cut(s) 228, 243, 262, 295
BstMBI GATC 4 cut(s) 225, 240, 259, 292
BstNSI RCATGY 2 cut(s) 15, 113
BstSLI GKGCMC 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 147
Cac8I GCNNGC 1 cut(s) 111
Csp6I GTAC 1 cut(s) 187
CviAII CATG 5 cut(s) 12, 16, 73, 91, 110
CviJI RGCY 4 cut(s) 98, 154, 212, 279
CviKI_1 RGCY 4 cut(s) 98, 154, 212, 279
CviQI GTAC 1 cut(s) 187
DdeI CTNAG 2 cut(s) 105, 216
DpnI GATC 4 cut(s) 227, 242, 261, 294
DpnII GATC 4 cut(s) 225, 240, 259, 292
Eam1104I CTCTTC 1 cut(s) 78
EarI CTCTTC 1 cut(s) 78
EcoT22I ATGCAT 1 cut(s) 17
FaeI CATG 5 cut(s) 15, 19, 76, 94, 113
FaiI YATR 7 cut(s) 13, 17, 23, 65, 74, 92, 111
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FatI CATG 5 cut(s) 11, 15, 72, 90, 109
FbaI TGATCA 1 cut(s) 292
FspBI CTAG 1 cut(s) 207
GsuI CTGGAG 1 cut(s) 176
Hin1II CATG 5 cut(s) 15, 19, 76, 94, 113
HphI GGTGA 1 cut(s) 19
Hpy166II GTNNAC 2 cut(s) 40, 189
Hpy188I TCNGA 3 cut(s) 217, 283, 297
Hpy188III TCNNGA 1 cut(s) 244
Hpy8I GTNNAC 2 cut(s) 40, 189
Hpy99I CGWCG 2 cut(s) 287, 290
HpyAV CCTTC 2 cut(s) 142, 154
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4V TGCA 5 cut(s) 15, 40, 60, 90, 113
HpyF3I CTNAG 2 cut(s) 105, 216
Hsp92II CATG 5 cut(s) 15, 19, 76, 94, 113
Ksp22I TGATCA 1 cut(s) 292
Kzo9I GATC 4 cut(s) 225, 240, 259, 292
LmnI GCTCC 2 cut(s) 151, 284
LpnPI CCDG 3 cut(s) 20, 140, 184
LweI GCATC 2 cut(s) 69, 240
MaeI CTAG 1 cut(s) 207
MaeIII GTNAC 1 cut(s) 7
MalI GATC 4 cut(s) 227, 242, 261, 294
MboI GATC 4 cut(s) 225, 240, 259, 292
MboII GAAGA 2 cut(s) 95, 259
MhlI GDGCHC 1 cut(s) 42
MnlI CCTC 5 cut(s) 46, 110, 145, 175, 223
Mph1103I ATGCAT 1 cut(s) 17
MseI TTAA 2 cut(s) 30, 47
NdeII GATC 4 cut(s) 225, 240, 259, 292
NlaIII CATG 5 cut(s) 15, 19, 76, 94, 113
NmuCI GTSAC 1 cut(s) 7
NsiI ATGCAT 1 cut(s) 17
NspI RCATGY 2 cut(s) 15, 113
PaeI GCATGC 1 cut(s) 113
PshBI ATTAAT 1 cut(s) 30
PsiI TTATAA 1 cut(s) 23
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
SaqAI TTAA 2 cut(s) 30, 47
Sau3AI GATC 4 cut(s) 225, 240, 259, 292
SduI GDGCHC 1 cut(s) 42
SetI ASST 4 cut(s) 39, 137, 156, 281
SfaNI GCATC 2 cut(s) 69, 240
SphI GCATGC 1 cut(s) 113
SspMI CTAG 1 cut(s) 207
TaaI ACNGT 1 cut(s) 142
TaqI TCGA 3 cut(s) 51, 243, 258
Tru1I TTAA 2 cut(s) 30, 47
Tru9I TTAA 2 cut(s) 30, 47
TscAI CASTG 1 cut(s) 147
TseFI GTSAC 1 cut(s) 7
Tsp45I GTSAC 1 cut(s) 7
TspRI CASTG 1 cut(s) 147
VneI GTGCAC 1 cut(s) 38
VspI ATTAAT 1 cut(s) 30
XceI RCATGY 2 cut(s) 15, 113
XspI CTAG 1 cut(s) 207
Zsp2I ATGCAT 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.