Rh3CG158700

Plant protein 1589 of unknown function (A_thal_3526)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
13327093 .. 13328656
1564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG158700.1

Sequence Viewer

Length: 252 bp
ATGAGCAGAGAAGAGTGCATGGAAGCCCTCTCCAAGCATGCAAATATAAAACCCATTATTACCTCCACAGTTTGGAAGGAGCTGGAGAAGGAGAACAAGGAGTTCTTTGAGGCCTACACAAACAGCAGAGAAGCTGTGAGAGAATCCAAAATGGAGAGAAAGCAAAGAATCCAGAAGATGCTTTCGGGTCATCTTTCTCAAACAGACACAGAGGACAGCAGCTGCACCAATACTACCGAATCCGACGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.67

Weight (kDa)

5.22

Isoelectric Point (pI)

68.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 1 - 40 1.4e-19 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 72
AluBI AGCT 3 cut(s) 82, 134, 222
AluI AGCT 3 cut(s) 82, 134, 222
AlwNI CAGNNNCTG 1 cut(s) 222
AoxI GGCC 1 cut(s) 111
ApeKI GCWGC 2 cut(s) 219, 222
BbvI GCAGC 2 cut(s) 209, 231
BfaI CTAG 1 cut(s) 250
BisI GCNGC 2 cut(s) 220, 223
BlsI GCNGC 2 cut(s) 221, 224
BmsI GCATC 1 cut(s) 168
BpmI CTGGAG 1 cut(s) 104
Bsc4I CCNNNNNNNGG 1 cut(s) 72
BseLI CCNNNNNNNGG 1 cut(s) 72
BseXI GCAGC 2 cut(s) 209, 231
BsgI GTGCAG 1 cut(s) 208
BshFI GGCC 1 cut(s) 113
BslI CCNNNNNNNGG 1 cut(s) 72
BsnI GGCC 1 cut(s) 113
BspANI GGCC 1 cut(s) 113
Bst4CI ACNGT 1 cut(s) 70
Bst6I CTCTTC 1 cut(s) 6
BstC8I GCNNGC 1 cut(s) 39
BstNSI RCATGY 1 cut(s) 41
BstV1I GCAGC 2 cut(s) 209, 231
BsuRI GGCC 1 cut(s) 113
Cac8I GCNNGC 1 cut(s) 39
CaiI CAGNNNCTG 1 cut(s) 222
CviAII CATG 2 cut(s) 19, 38
CviJI RGCY 5 cut(s) 26, 82, 113, 134, 222
CviKI_1 RGCY 5 cut(s) 26, 82, 113, 134, 222
Eam1104I CTCTTC 1 cut(s) 6
EarI CTCTTC 1 cut(s) 6
Eco147I AGGCCT 1 cut(s) 113
FaeI CATG 2 cut(s) 22, 41
FaiI YATR 3 cut(s) 20, 39, 47
FalI AAGNNNNNCTT 2 cut(s) 89, 121
FatI CATG 2 cut(s) 18, 37
Fnu4HI GCNGC 2 cut(s) 220, 223
Fsp4HI GCNGC 2 cut(s) 220, 223
FspBI CTAG 1 cut(s) 250
GluI GCNGC 2 cut(s) 220, 223
GsuI CTGGAG 1 cut(s) 104
HaeIII GGCC 1 cut(s) 113
Hin1II CATG 2 cut(s) 22, 41
HinfI GANTC 3 cut(s) 143, 168, 239
Hpy188I TCNGA 1 cut(s) 244
Hpy188III TCNNGA 1 cut(s) 172
Hpy99I CGWCG 1 cut(s) 248
HpyAV CCTTC 2 cut(s) 70, 82
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 3 cut(s) 18, 41, 225
Hsp92II CATG 2 cut(s) 22, 41
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 68, 185
Lsp1109I GCAGC 2 cut(s) 209, 231
LweI GCATC 1 cut(s) 168
MaeI CTAG 1 cut(s) 250
MboII GAAGA 2 cut(s) 23, 187
MnlI CCTC 4 cut(s) 38, 73, 103, 205
MspA1I CMGCKG 1 cut(s) 222
NlaIII CATG 2 cut(s) 22, 41
NspI RCATGY 1 cut(s) 41
PaeI GCATGC 1 cut(s) 41
PceI AGGCCT 1 cut(s) 113
PfeI GAWTC 3 cut(s) 143, 168, 239
PflMI CCANNNNNTGG 1 cut(s) 72
PkrI GCNGC 2 cut(s) 221, 224
PstNI CAGNNNCTG 1 cut(s) 222
PvuII CAGCTG 1 cut(s) 222
SatI GCNGC 2 cut(s) 220, 223
SetI ASST 4 cut(s) 65, 84, 136, 224
SfaNI GCATC 1 cut(s) 168
SgeI CNNG 7 cut(s) 31, 46, 50, 95, 109, 184, 198
SphI GCATGC 1 cut(s) 41
SseBI AGGCCT 1 cut(s) 113
SspMI CTAG 1 cut(s) 250
StuI AGGCCT 1 cut(s) 113
TaaI ACNGT 1 cut(s) 70
TfiI GAWTC 3 cut(s) 143, 168, 239
TseI GCWGC 2 cut(s) 219, 222
Van91I CCANNNNNTGG 1 cut(s) 72
XceI RCATGY 1 cut(s) 41
XspI CTAG 1 cut(s) 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.